Homebrew Analytics Formula Build Error Events (365 days)

Formula Build Error Events (365 days)

Period: 2025-10-28 to 2026-10-28, with 1,252,091 reported events.

Source and definitions

Source: Homebrew’s InfluxDB analytics, with notice and an opportunity to opt out before events are sent; JSON and collection details.

Category: Reported formula, including any options, not a unique user or machine.

Events: Reported formula build failures.

Unreported events are excluded; counts do not establish unique users or successful formula installations.

Rank Formula Events %
#1 glib 87,388 6.98%
#2 openssl@3 73,552 5.87%
#3 xcodesorg/made/xcodes 59,964 4.79%
#4 simdutf 58,496 4.67%
#5 poppler 42,778 3.42%
#6 gcc 36,262 2.90%
#7 gobject-introspection 34,344 2.74%
#8 sphinx-doc 33,334 2.66%
#9 cmake 32,905 2.63%
#10 python@3.15 22,385 1.79%
#11 steipete/tap/songsee 19,672 1.57%
#12 antoniorodr/memo/memo 18,983 1.52%
#13 doxygen 18,321 1.46%
#14 python@3.14 17,388 1.39%
#15 z3 17,303 1.38%
#16 libvmaf 15,488 1.24%
#17 pkgconf 14,855 1.19%
#18 git 14,655 1.17%
#19 sidneys/homebrew/openssl@1.0 14,494 1.16%
#20 p11-kit 14,110 1.13%
#21 qemu 14,029 1.12%
#22 gnutls 13,689 1.09%
#23 node 13,381 1.07%
#24 llvm 10,155 0.81%
#25 sqlite 10,116 0.81%
#26 gh 9,789 0.78%
#27 lima 9,531 0.76%
#28 mysql 8,915 0.71%
#29 cabal-install 8,579 0.69%
#30 ninja 8,136 0.65%
#31 openjdk 7,772 0.62%
#32 go 7,661 0.61%
#33 gettext 7,268 0.58%
#34 apple/apple/game-porting-toolkit-compiler 7,121 0.57%
#35 ffmpeg 6,905 0.55%
#36 cyrus-sasl 6,903 0.55%
#37 steipete/tap/sag 6,573 0.52%
#38 fontconfig 5,313 0.42%
#39 openresty/brew/openresty 5,203 0.42%
#40 node@22 5,127 0.41%
#41 mysql@8.0 5,108 0.41%
#42 gmp 4,881 0.39%
#43 libpq 4,880 0.39%
#44 nmap 4,244 0.34%
#45 openssl@4 4,092 0.33%
#46 libunistring 3,995 0.32%
#47 rust 3,936 0.31%
#48 expat 3,882 0.31%
#49 mpdecimal 3,637 0.29%
#50 timescale/tap/timescaledb 3,430 0.27%
#51 ollama 3,417 0.27%
#52 folly 3,229 0.26%
#53 dbus 3,186 0.25%
#54 php 3,066 0.24%
#55 ncurses 2,982 0.24%
#56 gdk-pixbuf 2,957 0.24%
#57 go-md2man 2,919 0.23%
#58 mysql-client 2,903 0.23%
#59 pandoc 2,843 0.23%
#60 python@3.13 2,602 0.21%
#61 oniguruma 2,504 0.20%
#62 andyyyy64/whichllm/whichllm 2,486 0.20%
#63 steipete/tap/wacli 2,433 0.19%
#64 bufbuild/buf/buf 2,415 0.19%
#65 pgvector 2,395 0.19%
#66 protobuf 2,391 0.19%
#67 d12frosted/emacs-plus/emacs-plus@30 2,343 0.19%
#68 apple/apple/game-porting-toolkit 2,292 0.18%
#69 llama.cpp --HEAD 2,284 0.18%
#70 cffi 2,277 0.18%
#71 shakacode/brew/curl-impersonate 2,274 0.18%
#72 itstool 2,251 0.18%
#73 lizardbyte/homebrew/sunshine 2,147 0.17%
#74 libuv 2,141 0.17%
#75 awscli 2,063 0.16%
#76 python@3.12 2,032 0.16%
#77 omnigent-ai/tap/omnigent 1,974 0.16%
#78 dav1d 1,940 0.15%
#79 upx 1,937 0.15%
#80 ada-url 1,922 0.15%
#81 jandedobbeleer/oh-my-posh/oh-my-posh 1,918 0.15%
#82 mysql@8.4 1,903 0.15%
#83 icu4c@78 1,895 0.15%
#84 railwaycat/emacsmacport/emacs-mac@29 1,888 0.15%
#85 llvm@21 1,866 0.15%
#86 telnet 1,866 0.15%
#87 leoafarias/fvm/fvm 1,856 0.15%
#88 zstd 1,851 0.15%
#89 python-tk@3.11 1,848 0.15%
#90 openssh 1,844 0.15%
#91 mvfst 1,778 0.14%
#92 xz 1,777 0.14%
#93 boost 1,704 0.14%
#94 dotnet 1,687 0.13%
#95 gromgit/fuse/ntfs-3g-mac 1,676 0.13%
#96 mole 1,665 0.13%
#97 x265 1,599 0.13%
#98 docker-compose 1,593 0.13%
#99 mpfr 1,570 0.13%
#100 sdl3 1,508 0.12%
#101 ghc 1,477 0.12%
#102 python@3.11 1,440 0.12%
#103 htop 1,415 0.11%
#104 louisbrunner/valgrind/valgrind --HEAD 1,405 0.11%
#105 mtr 1,380 0.11%
#106 redis 1,371 0.11%
#107 vde 1,366 0.11%
#108 pcre2 1,350 0.11%
#109 libpng 1,295 0.10%
#110 molten-vk 1,286 0.10%
#111 comfy-org/comfy-cli/comfy-cli 1,286 0.10%
#112 jpeg-turbo 1,280 0.10%
#113 homebrew-ffmpeg/ffmpeg/ffmpeg 1,266 0.10%
#114 postgresql@18 1,263 0.10%
#115 json-c 1,228 0.10%
#116 node@24 1,196 0.10%
#117 openjdk@8 1,166 0.09%
#118 librsvg 1,155 0.09%
#119 zbar 1,150 0.09%
#120 fzf 1,137 0.09%
#121 wpscanteam/tap/wpscan 1,133 0.09%
#122 shivammathur/php/php@7.4 1,121 0.09%
#123 gnupg 1,116 0.09%
#124 osrf/simulation/tinyxml1 1,111 0.09%
#125 steipete/tap/wacli --HEAD 1,108 0.09%
#126 llama.cpp 1,101 0.09%
#127 node@20 1,087 0.09%
#128 postgresql@17 1,079 0.09%
#129 swift 1,048 0.08%
#130 llvm@22 1,048 0.08%
#131 gromgit/fuse/bindfs-mac 1,042 0.08%
#132 pothosware/pothos/muparserx 1,035 0.08%
#133 gromgit/fuse/sshfs-mac 1,020 0.08%
#134 m4 1,018 0.08%
#135 whisper-cpp 1,012 0.08%
#136 qtbase 997 0.08%
#137 felixkratz/formulae/sketchybar 997 0.08%
#138 coreutils 994 0.08%
#139 openjdk@17 990 0.08%
#140 xiaomiku01/tap/tetherkit 975 0.08%
#141 d12frosted/emacs-plus/emacs-plus@31 959 0.08%
#142 simdjson 947 0.08%
#143 nativeos/i386-elf-toolchain/i386-elf-binutils 930 0.07%
#144 riscv-software-src/riscv/riscv-gnu-toolchain 929 0.07%
#145 php@8.4 919 0.07%
#146 php@8.3 909 0.07%
#147 ggml 907 0.07%
#148 brewsci/bio/iqtree 881 0.07%
#149 raullenchai/rapid-mlx/rapid-mlx 878 0.07%
#150 tehzz/n64-dev/mips64-elf-binutils 876 0.07%
#151 apr-util 872 0.07%
#152 fbthrift 870 0.07%
#153 cloudflared 838 0.07%
#154 kubernetes-cli 830 0.07%
#155 readline 829 0.07%
#156 tesseract 821 0.07%
#157 cartr/qt4/openssl@1.0 819 0.07%
#158 openjdk@21 810 0.06%
#159 randomplum/gtkwave/gtkwave --HEAD 808 0.06%
#160 python-tk@3.14 798 0.06%
#161 pothosware/pothos/libiio 794 0.06%
#162 watchman 794 0.06%
#163 michaeleisel/zld/zld 785 0.06%
#164 osrf/simulation/ignition-msgs5 779 0.06%
#165 php@8.2 776 0.06%
#166 icu4c@77 757 0.06%
#167 gromgit/fuse/ifuse-mac 747 0.06%
#168 krb5 739 0.06%
#169 webp 734 0.06%
#170 qpdf 729 0.06%
#171 httpd 709 0.06%
#172 bun 707 0.06%
#173 jpeg-xl 701 0.06%
#174 ccache 692 0.06%
#175 gdb 691 0.06%
#176 amiaopensource/amiaos/ffmpegdecklink 684 0.05%
#177 python-tk@3.10 679 0.05%
#178 libde265 665 0.05%
#179 eugenmayer/dockersync/unox 661 0.05%
#180 drawthingsai/draw-things/draw-things-cli --HEAD 660 0.05%
#181 libomp 658 0.05%
#182 jeffreywildman/virt-manager/virt-viewer 655 0.05%
#183 producerguy/tap/thermalforge 651 0.05%
#184 robusta-dev/krr/krr 649 0.05%
#185 exiftool 646 0.05%
#186 abseil 641 0.05%
#187 grafana/grafana/alloy 640 0.05%
#188 libtiff 639 0.05%
#189 git-lfs 634 0.05%
#190 homebrew-zathura/zathura/zathura 631 0.05%
#191 xo/xo/usql 628 0.05%
#192 imagemagick 623 0.05%
#193 lizardbyte/homebrew/sunshine-beta 613 0.05%
#194 azure-cli 609 0.05%
#195 gtk+3 608 0.05%
#196 lzip 606 0.05%
#197 curl 605 0.05%
#198 nasa-sw-vnv/core/ikos 596 0.05%
#199 swig 584 0.05%
#200 po4a 583 0.05%
#201 portaudio --HEAD 582 0.05%
#202 vapoursynth 578 0.05%
#203 gawk 576 0.05%
#204 unar 575 0.05%
#205 rclone 574 0.05%
#206 retroreversing/gdb-multiarch/gdb-multiarch 564 0.05%
#207 mysql-client@8.0 558 0.04%
#208 prosody/prosody/prosody 551 0.04%
#209 mistertea/et/et 525 0.04%
#210 mtg/essentia/essentia --HEAD 525 0.04%
#211 freshworks-developers/tap/fdk 513 0.04%
#212 blueutil 511 0.04%
#213 yt-dlp --HEAD 510 0.04%
#214 yt-dlp 509 0.04%
#215 glab 501 0.04%
#216 mesa 501 0.04%
#217 libheif 500 0.04%
#218 opencode 493 0.04%
#219 maelvls/amc/auto-multiple-choice 493 0.04%
#220 jfarcand/tap/mirroir-mcp 491 0.04%
#221 harfbuzz 485 0.04%
#222 uv 483 0.04%
#223 sevenzip 482 0.04%
#224 jstkdng/programs/ueberzugpp 482 0.04%
#225 libgit2 476 0.04%
#226 gbevin/tools/sendmidi 471 0.04%
#227 apache-arrow 468 0.04%
#228 microsoft/mssql-release/msodbcsql18 465 0.04%
#229 powershell 460 0.04%
#230 jdupes 458 0.04%
#231 the-openroad-project/lemon-graph/lemon-graph 457 0.04%
#232 smudge/smudge/nightlight 456 0.04%
#233 hudochenkov/sshpass/sshpass 454 0.04%
#234 rav1e 448 0.04%
#235 fwdcloudsec/granted/granted 446 0.04%
#236 jemalloc 445 0.04%
#237 net-snmp 444 0.04%
#238 neovim 443 0.04%
#239 dart-sdk 439 0.04%
#240 cliproxyapi 437 0.03%
#241 ottomatic-io/video/untrunc 437 0.03%
#242 mpg123 432 0.03%
#243 yoggy/tap/sendosc 430 0.03%
#244 duckdb 422 0.03%
#245 kismetwireless/kismet/kismet 422 0.03%
#246 osrf/simulation/gz-physics7 414 0.03%
#247 cloudflare/cloudflare/curl 413 0.03%
#248 blackmann/brew/zed-theme-importer 404 0.03%
#249 rconroy293/seventeenlands/seventeenlands 404 0.03%
#250 dotnet@9 402 0.03%
#251 blast 400 0.03%
#252 tfcollins/formulae/libiio 397 0.03%
#253 dashlane/tap/dashlane-cli 394 0.03%
#254 docker 392 0.03%
#255 rfidresearchgroup/proxmark3/proxmark3 391 0.03%
#256 opencv 386 0.03%
#257 airbytehq/tap/abctl 382 0.03%
#258 macos-fuse-t/cask/sshfs-fuse-t 382 0.03%
#259 wireshark 378 0.03%
#260 podman 378 0.03%
#261 python-tk@3.9 372 0.03%
#262 fish 370 0.03%
#263 gdal 369 0.03%
#264 0xxd0/tap/cartool 369 0.03%
#265 python@3.10 368 0.03%
#266 colima 368 0.03%
#267 tbb 366 0.03%
#268 tailscale 360 0.03%
#269 cairo 357 0.03%
#270 yazi --HEAD 355 0.03%
#271 subversion 352 0.03%
#272 rsync 351 0.03%
#273 tmux 349 0.03%
#274 libssh2 349 0.03%
#275 glibc 348 0.03%
#276 osrf/simulation/gz-fuel-tools9 348 0.03%
#277 espeak-ng 344 0.03%
#278 mongosh 338 0.03%
#279 onnxruntime 335 0.03%
#280 tomoyanonymous/flatcam/flatcam-evo 335 0.03%
#281 automake 334 0.03%
#282 segment-integrations/formulae/swift-create-xcframework 334 0.03%
#283 python-tk@3.13 333 0.03%
#284 purduesigbots/pros/pros-cli 332 0.03%
#285 amiaopensource/amiaos/gtkdialog 330 0.03%
#286 brewsci/bio/subread 330 0.03%
#287 cargo-c 327 0.03%
#288 lkrms/misc/gp-saml-gui 326 0.03%
#289 gemini-cli 323 0.03%
#290 sapd/headsetcontrol/headsetcontrol --HEAD 323 0.03%
#291 felixkratz/formulae/borders 321 0.03%
#292 tomoyanonymous/flatcam/flatcam-beta 316 0.03%
#293 php@8.1 315 0.03%
#294 dtc 315 0.03%
#295 icarus-verilog 313 0.02%
#296 syncthing 312 0.02%
#297 gcc@15 311 0.02%
#298 mininglamp-ai/tap/mano-cua 309 0.02%
#299 xmlto 306 0.02%
#300 grafana/grafana/gcx 305 0.02%
#301 gdbm 304 0.02%
#302 sbmpost/autoraise/autoraise 304 0.02%
#303 thefuck 303 0.02%
#304 ilpincy/argos3/argos3 302 0.02%
#305 aws-c-common 301 0.02%
#306 pipx 300 0.02%
#307 ipatool 300 0.02%
#308 riscv/riscv/riscv-gnu-toolchain 299 0.02%
#309 d99kris/nchat/nchat 296 0.02%
#310 ruffle-rs/ruffle/ruffle --HEAD 296 0.02%
#311 cocoapods 292 0.02%
#312 sqitchers/sqitch/sqitch --with-postgres-support 290 0.02%
#313 mysql-client@8.4 289 0.02%
#314 basicmachines-co/basic-memory/basic-memory 289 0.02%
#315 slp/krun/libkrun 286 0.02%
#316 postgresql@16 285 0.02%
#317 pango 283 0.02%
#318 aljohri/-/docx2pdf 282 0.02%
#319 shivammathur/php/php@7.3 281 0.02%
#320 yq 279 0.02%
#321 swiftlint 278 0.02%
#322 arm-none-eabi-gcc 277 0.02%
#323 ghostscript 273 0.02%
#324 filosottile/musl-cross/musl-cross 272 0.02%
#325 jabley/wrk2/wrk2 --HEAD 272 0.02%
#326 brewsci/bio/coot 271 0.02%
#327 helm 271 0.02%
#328 libimobiledevice-glue 271 0.02%
#329 ruby 270 0.02%
#330 handbrake 270 0.02%
#331 fizz 270 0.02%
#332 hugo 268 0.02%
#333 ripgrep 266 0.02%
#334 osrf/simulation/gz-launch7 265 0.02%
#335 mulbc/ceph-client/ceph-client 264 0.02%
#336 dubeykartikay/lazyspotify/lazyspotify 263 0.02%
#337 libsmi 262 0.02%
#338 dartaotruntime 261 0.02%
#339 brewsci/bio/coot --HEAD 261 0.02%
#340 node@18 261 0.02%
#341 ffmpeg --HEAD 260 0.02%
#342 e2fsprogs 256 0.02%
#343 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink 256 0.02%
#344 neovim --HEAD 256 0.02%
#345 freetype 255 0.02%
#346 libavif 254 0.02%
#347 mpv 253 0.02%
#348 hanningwang/tap/mano-cua 253 0.02%
#349 postgresql@14 252 0.02%
#350 quarkdown-labs/quarkdown/quarkdown 248 0.02%
#351 vancluever/input-leap/input-leap 248 0.02%
#352 d12frosted/emacs-plus/emacs-plus@29 --with-native-comp 245 0.02%
#353 qtdeclarative 244 0.02%
#354 rhettbull/osxphotos/osxphotos 243 0.02%
#355 libimobiledevice --HEAD 242 0.02%
#356 pothosware/pothos/soapybladerf 241 0.02%
#357 katago 241 0.02%
#358 gcc --HEAD 239 0.02%
#359 attr 238 0.02%
#360 homebrew-zathura/zathura/zathura --with-synctex 238 0.02%
#361 pothosware/pothos/soapyuhd 238 0.02%
#362 kpeeters/repo/cadabra2 236 0.02%
#363 eoleedi/tap/timetree-exporter 236 0.02%
#364 blacktop/tap/frida-tools 235 0.02%
#365 ollama --HEAD 233 0.02%
#366 gcenx/apple/game-porting-toolkit-compiler 233 0.02%
#367 zegervdv/zathura/zathura 232 0.02%
#368 icu4c@79 232 0.02%
#369 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac 231 0.02%
#370 shopify/shopify/shopify-cli 231 0.02%
#371 fredowski/pspp/pspp 229 0.02%
#372 tcl-tk 229 0.02%
#373 rom-tools 227 0.02%
#374 shivammathur/php/php@7.2 224 0.02%
#375 brewsci/science/openni2 224 0.02%
#376 px4/px4/asio@1.10.8 223 0.02%
#377 robusta-dev/holmesgpt/holmesgpt 222 0.02%
#378 osrf/simulation/gz-physics9 222 0.02%
#379 direnv 221 0.02%
#380 libvpx 221 0.02%
#381 smartmontools 221 0.02%
#382 ubuntu/microk8s/microk8s 220 0.02%
#383 openjph 220 0.02%
#384 d12frosted/emacs-plus/emacs-plus@32 220 0.02%
#385 trivy 220 0.02%
#386 imagesnap 220 0.02%
#387 mecab 216 0.02%
#388 moonbase59/tap/loudgain 215 0.02%
#389 rfidresearchgroup/proxmark3/proxmark3 --with-generic 215 0.02%
#390 assimp 214 0.02%
#391 alexei-led/tap/ccgram 214 0.02%
#392 perl 210 0.02%
#393 terminal-notifier 209 0.02%
#394 aria2 209 0.02%
#395 xen0l/taps/aws-gate 209 0.02%
#396 pillow 208 0.02%
#397 pygobject3 208 0.02%
#398 labstreaminglayer/tap/lsl 208 0.02%
#399 pulseaudio 208 0.02%
#400 riscv-software-src/riscv/riscv-openocd 207 0.02%
#401 libplist 207 0.02%
#402 andrewdski/openwebui/openwebui 207 0.02%
#403 libxml2 206 0.02%
#404 ghidra 204 0.02%
#405 xcodegen 203 0.02%
#406 xcodes 203 0.02%
#407 switchaudio-osx 202 0.02%
#408 osrf/simulation/gz-fuel-tools11 201 0.02%
#409 mongodb/brew/libmongocrypt 200 0.02%
#410 sdl2-compat 200 0.02%
#411 sapd/headsetcontrol/headsetcontrol 200 0.02%
#412 stripe/stripe-cli/stripe 199 0.02%
#413 borgbackup/tap/borgbackup-fuse 199 0.02%
#414 d12frosted/emacs-plus/emacs-plus@29 199 0.02%
#415 gstreamer 198 0.02%
#416 libx11 198 0.02%
#417 stass/tap/blew 198 0.02%
#418 aircrack-ng 196 0.02%
#419 aliyun-cli 195 0.02%
#420 binutils 195 0.02%
#421 sidneys/homebrew/untrunc 194 0.02%
#422 mariadb 194 0.02%
#423 scrcpy 193 0.02%
#424 tencentcloud/tccli/tccli 192 0.02%
#425 sidneys/homebrew/chntpw 190 0.02%
#426 tinyhumansai/core/openhuman 188 0.02%
#427 openjdk@11 188 0.02%
#428 avrdude 187 0.01%
#429 xray 186 0.01%
#430 startergo/qemu-virgl-kosmickrisp/qemu 186 0.01%
#431 zsh 185 0.01%
#432 garnajee/perso/nm3u8dl-re 184 0.01%
#433 v2ray 183 0.01%
#434 thetom/tap/vllm-swift 183 0.01%
#435 gromgit/fuse/dislocker-mac 183 0.01%
#436 proxmark/proxmark3/proxmark3 182 0.01%
#437 cryptography 181 0.01%
#438 pydantic 179 0.01%
#439 chipmk/tap/docker-mac-net-connect 179 0.01%
#440 microsoft/mssql-release/msodbcsql17 177 0.01%
#441 backbase/m/variants 177 0.01%
#442 caddy 177 0.01%
#443 pytorch 177 0.01%
#444 sing-box 175 0.01%
#445 gnuplot 175 0.01%
#446 libpsl 175 0.01%
#447 a7ex/formulae/xcresultparser@1.7.2 175 0.01%
#448 robotsandpencils/made/xcodes 174 0.01%
#449 openresty/brew/openresty-openssl3 174 0.01%
#450 libiconv 174 0.01%
#451 robotjie/tap/mdns-reflector-go 174 0.01%
#452 aom 174 0.01%
#453 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick 174 0.01%
#454 tgtakaoka/mspgcc/binutils-msp430 172 0.01%
#455 pothosware/pothos/soapyairspy 171 0.01%
#456 at-spi2-core 171 0.01%
#457 gpgme 171 0.01%
#458 asciidoc 170 0.01%
#459 shivammathur/php/php 168 0.01%
#460 leptonica 167 0.01%
#461 ytsutano/toolbox/axmldec 167 0.01%
#462 nss 167 0.01%
#463 openresty/brew/openresty --without-geoip 167 0.01%
#464 helix --HEAD 166 0.01%
#465 numpy 166 0.01%
#466 brotli 165 0.01%
#467 d235j/ios-restore-tools/idevicerestore 164 0.01%
#468 igorkha/rkdeveloptool/rkdeveloptool 164 0.01%
#469 yb85/tap/scantailor-advanced 163 0.01%
#470 dunglas/frankenphp/frankenphp 162 0.01%
#471 silverstein/tap/minutes 162 0.01%
#472 root 161 0.01%
#473 open-mpi 160 0.01%
#474 qemu --HEAD 159 0.01%
#475 deno 159 0.01%
#476 kazuakiyama/difmap/difmap 159 0.01%
#477 gnu-tar 158 0.01%
#478 asciidoctor 158 0.01%
#479 shivammathur/php/php@8.2 158 0.01%
#480 swiftwasm/tap/carton 158 0.01%
#481 b-nnett/codex-plusplus/codexplusplus 157 0.01%
#482 ffmpeg@6 157 0.01%
#483 dotnet@8 156 0.01%
#484 tmux --HEAD 156 0.01%
#485 ncar/lrose/lrose-core 155 0.01%
#486 gary149/llama-agent/llama-agent 154 0.01%
#487 iina/mpv-iina/mpv-iina --HEAD 154 0.01%
#488 pothosware/pothos/pothos 154 0.01%
#489 human37/open-wispr/open-wispr 154 0.01%
#490 openexr 154 0.01%
#491 alisw/system-deps/alibuild 153 0.01%
#492 danwald/hugin/hugin-src-2025 153 0.01%
#493 nrvim/tap/garmin-givemydata 152 0.01%
#494 mopidy/mopidy/mopidy 152 0.01%
#495 gbevin/tools/receivemidi 152 0.01%
#496 flyctl 151 0.01%
#497 unibilium 151 0.01%
#498 sass/sass/sass 151 0.01%
#499 dolt 150 0.01%
#500 fb303 150 0.01%
#501 sbcl 150 0.01%
#502 shivammathur/php/php@8.4 150 0.01%
#503 robotlocomotion/director/ibex@2.7.4 149 0.01%
#504 tamarin-prover/tap/maude 149 0.01%
#505 grimme-lab/qc/crest 149 0.01%
#506 mutagen-io/mutagen/mutagen 149 0.01%
#507 nginx 147 0.01%
#508 wireguard-go 147 0.01%
#509 fmt 147 0.01%
#510 wimlib 147 0.01%
#511 luarocks 146 0.01%
#512 sqitchers/sqitch/sqitch --with-postgres-support --with-sqlite-support 145 0.01%
#513 abcde 145 0.01%
#514 rustup 144 0.01%
#515 apache-serf 142 0.01%
#516 brewsci/bio/megahit 142 0.01%
#517 minikube 142 0.01%
#518 davidchall/hep/cernlib 142 0.01%
#519 pkcs11-helper 142 0.01%
#520 superbet-group/tap/bedrock-token-helper 140 0.01%
#521 mhzawadi/cbonsai/cbonsai 138 0.01%
#522 shivammathur/php/php@8.3 138 0.01%
#523 pre-commit 137 0.01%
#524 gogcli 136 0.01%
#525 libimobiledevice 136 0.01%
#526 startergo/angle/angle 136 0.01%
#527 llvm@20 135 0.01%
#528 rfidresearchgroup/proxmark3/proxmark3 --HEAD 133 0.01%
#529 envoy 133 0.01%
#530 f3 133 0.01%
#531 pothosware/pothos/soapyaudio 132 0.01%
#532 tomanthony/brews/itermocil 132 0.01%
#533 c2patool 132 0.01%
#534 gsl 131 0.01%
#535 yagcioglutoprak/aiquotabar/aiquotabar --HEAD 131 0.01%
#536 ocrmypdf 131 0.01%
#537 postgis 130 0.01%
#538 nuclei 129 0.01%
#539 librearp/librearp/librearp 129 0.01%
#540 libvirt 128 0.01%
#541 openjdk@25 127 0.01%
#542 cactus-compute/cactus/cactus 127 0.01%
#543 btop 126 0.01%
#544 mint 126 0.01%
#545 herdr 125 0.01%
#546 algertc/kleopatra4mac/kleopatra 124 0.01%
#547 httpie 124 0.01%
#548 elfutils 124 0.01%
#549 atomvm/atomvm/atomvm 124 0.01%
#550 areofyl/fetch/fetch-git 123 0.01%
#551 postgresql@15 123 0.01%
#552 macvim 123 0.01%
#553 pidcat --HEAD 123 0.01%
#554 sqitchers/sqitch/sqitch 123 0.01%
#555 rockorager/tap/prise 122 0.01%
#556 docker-buildx 121 0.01%
#557 brycensranch/repo/snapx 120 0.01%
#558 lz4 120 0.01%
#559 tgtakaoka/msp430-elf/binutils-msp430-elf 119 0.01%
#560 gdal --HEAD 119 0.01%
#561 j-x-z/tap/waypipe-darwin 118 0.01%
#562 tomahawk-player/tomahawkqt5/liblastfm 118 0.01%
#563 codacy/tap/codacy-analysis-cli 118 0.01%
#564 aws-c-cal 117 0.01%
#565 mame 117 0.01%
#566 inivation/inivation/dv-processing 117 0.01%
#567 swiftformat 116 0.01%
#568 mupdf 116 0.01%
#569 nohajc/anylinuxfs/anylinuxfs 116 0.01%
#570 semgrep 116 0.01%
#571 gsettings-desktop-schemas 116 0.01%
#572 shopify/shopify/openssl 115 0.01%
#573 brewsci/bio/gemmi 115 0.01%
#574 make 114 0.01%
#575 shivammathur/php/php@5.6 114 0.01%
#576 glow 114 0.01%
#577 kind 113 0.01%
#578 bash 112 0.01%
#579 osrf/simulation/ignition-physics5 112 0.01%
#580 frpc 111 0.01%
#581 majd/repo/class-dump 111 0.01%
#582 alesbrelih/gitlab-ci-ls/gitlab-ci-ls 111 0.01%
#583 lame 111 0.01%
#584 r 110 0.01%
#585 gts 109 0.01%
#586 kismetwireless/kismet/kismet-git --HEAD 109 0.01%
#587 waydabber/betterdisplay/betterdisplaycli 109 0.01%
#588 arb-project/arb/arb 109 0.01%
#589 arb-project/arb/arb --HEAD 109 0.01%
#590 kanoi/cgminer/cgminer 109 0.01%
#591 brewsci/bio/mmdb2 109 0.01%
#592 mihomo 109 0.01%
#593 protobuf@21 108 0.01%
#594 arb-project/arb/arb@7 107 0.01%
#595 cozycactus/tap/soapyrx888 107 0.01%
#596 expect 107 0.01%
#597 pothosware/pothos/airspyhf 107 0.01%
#598 qttools 106 0.01%
#599 holek/rcon/rcon 106 0.01%
#600 vips 106 0.01%
#601 openvino 105 0.01%
#602 pgloader 105 0.01%
#603 chargepoint/xcparse/xcparse 104 0.01%
#604 d12frosted/emacs-plus/emacs-plus@31 --with-xwidgets 104 0.01%
#605 lexiforest/tap/curl-cffi 104 0.01%
#606 fastfetch 103 0.01%
#607 gost 103 0.01%
#608 swift-format 103 0.01%
#609 pothosware/pothos/soapyredpitaya 103 0.01%
#610 qt3d 103 0.01%
#611 humansignal/tap/label-studio 103 0.01%
#612 radare2 102 0.01%
#613 thash/asana/asana 102 0.01%
#614 fluid-synth 102 0.01%
#615 conky-for-macos/formulae/conky 102 0.01%
#616 util-linux 102 0.01%
#617 therion/therion/therion 102 0.01%
#618 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd 101 0.01%
#619 age 101 0.01%
#620 giflib 101 0.01%
#621 kanidm/kanidm/kanidm 101 0.01%
#622 199-biotechnologies/tap/search-cli 100 0.01%
#623 kionsoftware/tap/kion-cli 100 0.01%
#624 erlang 100 0.01%
#625 chipsalliance/verible/verible 99 0.01%
#626 freecad/freecad/shiboken2@5.15.5 99 0.01%
#627 i686-elf-gcc 99 0.01%
#628 livekit-cli 99 0.01%
#629 lftp 98 0.01%
#630 pointfreeco/tap/pfw 98 0.01%
#631 wxwidgets 98 0.01%
#632 rpm 98 0.01%
#633 faiss 98 0.01%
#634 d12frosted/emacs-plus/emacs-plus@30 --with-xwidgets 97 0.01%
#635 cosmojg/tap/doc2docx 97 0.01%
#636 pothosware/pothos/libmirisdr --HEAD 97 0.01%
#637 opentofu 97 0.01%
#638 mergestat/mergestat/mergestat 97 0.01%
#639 koekeishiya/formulae/skhd 96 0.01%
#640 rdp/openssh-gssapi/openssh-patched --with-gssapi-support 96 0.01%
#641 x86_64-elf-gcc 96 0.01%
#642 thoughtbot/formulae/gitsh 96 0.01%
#643 netcdf 96 0.01%
#644 shared-mime-info 95 0.01%
#645 skwallace36/pepper/pepper --HEAD 95 0.01%
#646 wxwidgets@3.2 94 0.01%
#647 startergo/virglrenderer/virglrenderer 94 0.01%
#648 octoenergy/tap/kraken-cli 94 0.01%
#649 rickty94/tellr/tellr 94 0.01%
#650 openblas 93 0.01%
#651 davep/homebrew/hike 93 0.01%
#652 python-gdbm@3.11 93 0.01%
#653 mingw-w64 93 0.01%
#654 osx-cross/avr/avr-gcc@9 93 0.01%
#655 antoniorodr/cronboard/cronboard 92 0.01%
#656 shivammathur/php/php@8.0 91 0.01%
#657 benwebber/tunnelblickctl/tunnelblickctl 91 0.01%
#658 szwathub/tap/cartool 90 0.01%
#659 golangci-lint 90 0.01%
#660 narugit/tap/smctemp 90 0.01%
#661 xmds2/xmds2/xmds2 89 0.01%
#662 mtg/essentia/essentia --HEAD --with-tensorflow 89 0.01%
#663 mise 89 0.01%
#664 libusbmuxd --HEAD 89 0.01%
#665 cloudflare/cloudflare/cf-terraforming 89 0.01%
#666 qtmultimedia 89 0.01%
#667 esolitos/ipa/sshpass 88 0.01%
#668 sdl2_image 88 0.01%
#669 libsodium 88 0.01%
#670 zeroc-ice/tap/ice@3.7 87 0.01%
#671 pybind11 87 0.01%
#672 libssh 87 0.01%
#673 asdf 87 0.01%
#674 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark 86 0.01%
#675 hak5/wifi-coconut/wifi-coconut 86 0.01%
#676 searlsco/tap/imsg 86 0.01%
#677 tonidy/tools-tap/mkpasswd 86 0.01%
#678 baresip 86 0.01%
#679 buf 85 0.01%
#680 emacs 85 0.01%
#681 tgragnato/tap/amule 85 0.01%
#682 david0/audio/calf --HEAD 85 0.01%
#683 jichu4n/palm-os/prc-tools 85 0.01%
#684 re2c 85 0.01%
#685 vte3 85 0.01%
#686 temporal 85 0.01%
#687 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp 84 0.01%
#688 socialfinance/sofi/docker-forward 84 0.01%
#689 milvus-io/milvus/milvus 84 0.01%
#690 samuelmeuli/tap/tmignore 84 0.01%
#691 wouterdebie/repo/i2cssh 84 0.01%
#692 osrf/simulation/gz-physics8 84 0.01%
#693 fribidi 84 0.01%
#694 apaffenholz/polymake/polymake 84 0.01%
#695 siguremo/tap/yutto 84 0.01%
#696 homebrew-ffmpeg/ffmpeg/ffmpeg --with-srt 84 0.01%
#697 buildifier 83 0.01%
#698 osrf/simulation/gz-gui10 83 0.01%
#699 llvm@16 83 0.01%
#700 pinentry-mac 83 0.01%
#701 wget 83 0.01%
#702 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-generic 83 0.01%
#703 abinit/tap/abinit 83 0.01%
#704 ios-deploy 83 0.01%
#705 a7ex/formulae/xcresultparser 82 0.01%
#706 macaulay2/tap/macaulay2 82 0.01%
#707 qtsvg 82 0.01%
#708 podman-compose 82 0.01%
#709 maturin 82 0.01%
#710 ozeias/postgresql/postgis@15 82 0.01%
#711 buildozer 82 0.01%
#712 netpbm 82 0.01%
#713 vim 81 0.01%
#714 freerdp 81 0.01%
#715 philpennock/protocols/sieve-connect 81 0.01%
#716 brewsci/bio/gemma 81 0.01%
#717 brewsci/bio/libccp4 81 0.01%
#718 streamlink 80 0.01%
#719 brewsci/bio/epa-ng 80 0.01%
#720 nightwatcher314/formula/zotero-pdf2zh-next 80 0.01%
#721 mercurial 80 0.01%
#722 kris-anderson/netperf/netperf-enable-demo 80 0.01%
#723 pothosware/pothos/soapyrtlsdr 80 0.01%
#724 groonga 80 0.01%
#725 qtquick3d 79 0.01%
#726 carthage 79 0.01%
#727 simonw/llm/llm 79 0.01%
#728 rdkit 79 0.01%
#729 gromgit/fuse/ext4fuse-mac 79 0.01%
#730 appstream 79 0.01%
#731 python-tk@3.12 79 0.01%
#732 tehzz/n64-dev/mips64-elf-gcc 79 0.01%
#733 openal-soft 79 0.01%
#734 opalsecurity/brew/opal-security 79 0.01%
#735 pchuri/tap/confluence-cli 78 0.01%
#736 k6 78 0.01%
#737 openvpn 78 0.01%
#738 joshavant/tap/clawbox 77 0.01%
#739 yosys 77 0.01%
#740 testball1 77 0.01%
#741 timescaledb/tap/timescaledb 76 0.01%
#742 osx-cross/avr/simavr --HEAD 76 0.01%
#743 pothosware/pothos/soapyiris 75 0.01%
#744 cython 75 0.01%
#745 slp/krunkit/krunkit 75 0.01%
#746 aider 75 0.01%
#747 gitleaks 75 0.01%
#748 onnx 75 0.01%
#749 osx-cross/avr/avr-binutils 75 0.01%
#750 vapor 75 0.01%
#751 osrf/simulation/gazebo11 75 0.01%
#752 ocaml 74 0.01%
#753 robotology/formulae/ode 74 0.01%
#754 openjpeg 74 0.01%
#755 qtwebengine 73 0.01%
#756 tnishinaga/sigrok/sigrok-firmware-fx2lafw 73 0.01%
#757 unbound 73 0.01%
#758 bmake 72 0.01%
#759 osrf/simulation/gz-harmonic 72 0.01%
#760 temporalio/brew/tcld 72 0.01%
#761 bazel 72 0.01%
#762 railwaycat/emacsmacport/emacs-mac@29 --with-modern-icon 72 0.01%
#763 hdf5 72 0.01%
#764 swiftdocorg/formulae/swift-doc 72 0.01%
#765 f/mcptools/mcp 72 0.01%
#766 grimme-lab/qc/xtb 72 0.01%
#767 neovide --HEAD 71 0.01%
#768 sttz/tap/expresso 71 0.01%
#769 osrf/simulation/gz-common7 71 0.01%
#770 openldap 71 0.01%
#771 yulrizka/tap/pushtotalk 71 0.01%
#772 htrb/tap/ngraph-gtk 71 0.01%
#773 brewsci/science/calculix-ccx 71 0.01%
#774 zig 70 0.01%
#775 wiltodelta/tap/remove-ai-watermarks 70 0.01%
#776 arduino-cli 70 0.01%
#777 snappy 70 0.01%
#778 swi-prolog --HEAD 70 0.01%
#779 v8 70 0.01%
#780 gcc@14 69 0.01%
#781 verilator 69 0.01%
#782 evanpurkhiser/personal/keyfinder-cli 69 0.01%
#783 ldid 69 0.01%
#784 osrf/simulation/gz-sim10 69 0.01%
#785 zegervdv/zathura/zathura --with-synctex 69 0.01%
#786 aspell 69 0.01%
#787 nasa-sw-vnv/core/apron 69 0.01%
#788 uhd 68 0.01%
#789 libmpc 68 0.01%
#790 numworks/tap/epsilon-sdk 68 0.01%
#791 textualize/homebrew/frogmouth 68 0.01%
#792 minizip 68 0.01%
#793 pstoedit 68 0.01%
#794 openclaw/tap/wacli --HEAD 68 0.01%
#795 scipy 67 0.01%
#796 sqlcipher 67 0.01%
#797 gitlab-runner 67 0.01%
#798 code-server 67 0.01%
#799 matthart1983/tap/netwatch 67 0.01%
#800 x264 67 0.01%
#801 lizardbyte/homebrew/sunshine-beta --with-cuda 66 0.01%
#802 rbenv/tap/openssl@1.1 66 0.01%
#803 innoextract --HEAD 66 0.01%
#804 peteonrails/voxtype/voxtype 66 0.01%
#805 roboticslibrary/rl/rl 66 0.01%
#806 minicom 66 0.01%
#807 systemd 66 0.01%
#808 libidn2 65 0.01%
#809 yb85/tap/scantailor-advanced --HEAD 65 0.01%
#810 imapsync 65 0.01%
#811 utf8proc 65 0.01%
#812 gerbera/gerbera/gerbera 64 0.01%
#813 d99kris/nchat/nchat --without-telegram 64 0.01%
#814 homebrew-ffmpeg/ffmpeg/ffmpeg --with-webp 64 0.01%
#815 texinfo 64 0.01%
#816 libmagic 64 0.01%
#817 hf 64 0.01%
#818 clevercloud/tap/clever-tools 63 0.01%
#819 brewsci/bio/viennarna 63 0.01%
#820 kyleconroy/sqlc/sqlc 63 0.01%
#821 scons 63 0.01%
#822 sidneys/homebrew/unrar 63 0.01%
#823 cliproxyapi --HEAD 63 0.01%
#824 rtk 63 0.01%
#825 tfcollins/formulae/libad9361-iio 63 0.01%
#826 just 63 0.01%
#827 ansible 63 0.01%
#828 brewsci/bio/bamm 63 0.01%
#829 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-xwidgets 63 0.01%
#830 libfido2 63 0.01%
#831 poetry 63 0.01%
#832 graphviz 63 0.01%
#833 sdkman/tap/sdkman-cli 62 0%
#834 yanjiew1/gtkwave/gtkwave 62 0%
#835 osrf/simulation/simbody 62 0%
#836 domq/gdb/gdb 62 0%
#837 shivammathur/php/php@8.1 62 0%
#838 cocoanetics/tap/codexmonitor 62 0%
#839 jayadamsmorgan/yatoro/yatoro 62 0%
#840 brewsci/num/brewsci-metis 62 0%
#841 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation 62 0%
#842 grpc 62 0%
#843 ggerganov/ggerganov/waver 62 0%
#844 k9s 62 0%
#845 datahub-project/tap/datahub 61 0%
#846 yagcioglutoprak/aiquotabar/aiquotabar 61 0%
#847 spirv-llvm-translator 61 0%
#848 agrinman/tap/tunnelto 61 0%
#849 ta-lib 61 0%
#850 joedrago/repo/avifenc 61 0%
#851 go@1.21 61 0%
#852 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libvmaf 60 0%
#853 kimi-cli 60 0%
#854 hello 60 0%
#855 steipete/tap/birdclaw 60 0%
#856 d235j/ios-restore-tools/gaster --HEAD 60 0%
#857 macaulay2/tap/factory 60 0%
#858 casacore/tap/casacore 59 0%
#859 renovate 59 0%
#860 pegasus-isi/tools/pegasus@5 59 0%
#861 railwaycat/emacsmacport/emacs-mac@29 --HEAD 59 0%
#862 osrf/simulation/gz-fuel-tools10 59 0%
#863 skopeo 59 0%
#864 shyiko/kubesec/kubesec 58 0%
#865 libusb 58 0%
#866 fceux 58 0%
#867 libwebsockets 58 0%
#868 livekit 58 0%
#869 libnghttp2 58 0%
#870 homebrew-ffmpeg/ffmpeg/ffmpeg --with-whisper-cpp 58 0%
#871 libtorrent-rakshasa 58 0%
#872 slp/krunkit/libkrun-efi 58 0%
#873 d235j/ios-restore-tools/ra1nsn0w --HEAD 58 0%
#874 homebrew/brew-vulns/brew-vulns 57 0%
#875 mitie 57 0%
#876 grpcurl 57 0%
#877 ameshkov/tap/dnslookup 57 0%
#878 bazelisk 57 0%
#879 openssl@3.5 57 0%
#880 matt-chapman/python2/python@2 57 0%
#881 gcc@12 57 0%
#882 osm2pgsql 57 0%
#883 yazi 57 0%
#884 trunkrecorder/install/trunk-recorder 56 0%
#885 apr 56 0%
#886 open-ocd --HEAD 56 0%
#887 hughbien/tap/mark 56 0%
#888 hydra 56 0%
#889 brewsci/bio/raxml 56 0%
#890 yvgude/lean-ctx/lean-ctx 56 0%
#891 ilikejam/csshi/csshi 56 0%
#892 golang-migrate 56 0%
#893 rocq 56 0%
#894 dpkg 56 0%
#895 pcsc-lite 55 0%
#896 pnpm 55 0%
#897 slp/krun/virglrenderer 55 0%
#898 libevent 55 0%
#899 homebrew-ffmpeg/ffmpeg/ffmpeg --with-zimg 55 0%
#900 redex 55 0%
#901 pachi 55 0%
#902 datuet/dmg/mobile-generate 54 0%
#903 silver-flight-group/tap/kakaocli 54 0%
#904 trufflehog 54 0%
#905 brewsci/bio/sepp 54 0%
#906 git --HEAD 54 0%
#907 gpgmepp 54 0%
#908 elastic/tap/elasticsearch-full 54 0%
#909 bates64/brew/mips-linux-gnu-binutils 54 0%
#910 libkrunfw 54 0%
#911 ldomaradzki/xcsift/xcsift 53 0%
#912 vtk 53 0%
#913 wine 53 0%
#914 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libvidstab 53 0%
#915 chromaprint 52 0%
#916 runc 52 0%
#917 uetchy/nlp/knp 52 0%
#918 mediaarea/mediaarea/dvrescue 52 0%
#919 thought-machine/please/please 52 0%
#920 vmware/pinniped/pinniped-cli 52 0%
#921 px4/px4/kconfig-frontends 52 0%
#922 isa-l 52 0%
#923 tdlib --HEAD 52 0%
#924 shivammathur/php/php@7.1 52 0%
#925 git-annex 52 0%
#926 goenv 51 0%
#927 flang 51 0%
#928 diamond 51 0%
#929 ldid-procursus --HEAD 51 0%
#930 eclipse-cdt/tools/lldb-mi --HEAD 51 0%
#931 zegervdv/zathura/zathura --HEAD --with-synctex 51 0%
#932 nwoolls/xgminer/cgminer 51 0%
#933 moves-rwth/storm/stormchecker 51 0%
#934 takesako/sigrok/libsigrokdecode 50 0%
#935 python@3.9 50 0%
#936 grafana 50 0%
#937 libtool 50 0%
#938 gnuradio 50 0%
#939 unixodbc 50 0%
#940 mlt 50 0%
#941 mlx 50 0%
#942 ffmpeg-full 49 0%
#943 vinivendra/gryphon/gryphon 49 0%
#944 colima --HEAD 49 0%
#945 svt-av1 49 0%
#946 codekitchen/dinghy/unfs3 49 0%
#947 kakoune 49 0%
#948 watchman --HEAD 49 0%
#949 aws-sdk-cpp 49 0%
#950 ffuf 49 0%
#951 nethack 49 0%
#952 xiaomiku01/tap/tetherkit-cli 49 0%
#953 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 49 0%
#954 starship 49 0%
#955 idoavrah/homebrew/tftui 49 0%
#956 yaviral17/macos-rufus/macos-rufus 49 0%
#957 ska-sa/tap/casacore 49 0%
#958 minacle/chntpw/chntpw 49 0%
#959 libthai 48 0%
#960 xcodesorg/made/xcodes --HEAD 48 0%
#961 edencommon 48 0%
#962 terror/tap/just-lsp 48 0%
#963 pipenv 48 0%
#964 valhalla/valhalla/prime_server 48 0%
#965 osx-cross/avr/avr-gcc@8 48 0%
#966 sdl2 48 0%
#967 zls --HEAD 48 0%
#968 hopenpgp-tools 48 0%
#969 homebrew-zathura/zathura/zathura-pdf-mupdf 48 0%
#970 steipete/tap/oracle 48 0%
#971 getsentry/tools/sentry-wizard 48 0%
#972 homebrew-zathura/zathura/zathura --HEAD 48 0%
#973 cartman-kai/thrift/thrift@0.12 48 0%
#974 chernistry/bernstein/bernstein 48 0%
#975 piste2750/ltfs/ltfs 47 0%
#976 hiredis 47 0%
#977 sptim/formulae/pdfbooklet 47 0%
#978 kraken2 47 0%
#979 openapi-generator --HEAD 47 0%
#980 mapbox/cli/mapbox 47 0%
#981 vercel 47 0%
#982 libtatsu 47 0%
#983 pulumi 47 0%
#984 indilib/indi/libindi 47 0%
#985 chronograf 47 0%
#986 railwaycat/emacsmacport/emacs-mac@29 --without-modules 47 0%
#987 p7zip 47 0%
#988 moganlab/goldfish/goldfish 47 0%
#989 dotnet@6 47 0%
#990 docker-machine 47 0%
#991 mpv --HEAD 47 0%
#992 osx-cross/arm/arm-none-eabi-binutils 47 0%
#993 zeek 47 0%
#994 osrf/simulation/ogre1.9-with-boost1.85 47 0%
#995 jadx 47 0%
#996 osrf/simulation/gz-transport13 47 0%
#997 smart-mcp-proxy/mcpproxy/mcpproxy 46 0%
#998 forthy42/zsh/yodl 46 0%
#999 jamf/internal-tap/cloudtools@9 46 0%
#1,000 luajit 46 0%
#1,001 clang-format 46 0%
#1,002 marcus/tap/sidecar 46 0%
#1,003 harmonybrew/core/bun 46 0%
#1,004 gromgit/fuse/s3fs-mac 46 0%
#1,005 rene-dev/sigrok/libsigrokdecode 46 0%
#1,006 tracy 46 0%
#1,007 twam/openfpga/prjtrellis 46 0%
#1,008 simdutf --HEAD 46 0%
#1,009 ohueter/tap/autokbisw 46 0%
#1,010 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-srt 46 0%
#1,011 sidaf/pentest/polenum 46 0%
#1,012 libgccjit 46 0%
#1,013 ipsw 46 0%
#1,014 osrf/simulation/gz-utils4 45 0%
#1,015 hermes-agent 45 0%
#1,016 cssr-tools/opm/resinsight 45 0%
#1,017 facebook/fb/idb-cli 45 0%
#1,018 leaperone/smctl/smctl 45 0%
#1,019 cartr/qt4/qt@4 45 0%
#1,020 dapr/tap/dapr-cli 45 0%
#1,021 ozeias/postgresql/postgis@16 45 0%
#1,022 shell-pool/shpool/shpool 45 0%
#1,023 swi-prolog 45 0%
#1,024 openmha/tap/openmha 45 0%
#1,025 arpack 45 0%
#1,026 osrf/simulation/gz-jetty 45 0%
#1,027 ddrescue 45 0%
#1,028 mickeyl/formulae/core-bluetooth-tool 45 0%
#1,029 fzj-jsc/scalasca/cubegui --HEAD 45 0%
#1,030 xo/xo/usql --with-odbc 45 0%
#1,031 gigalixir/brew/gigalixir 45 0%
#1,032 timescale/tap/timescaledb-toolkit 44 0%
#1,033 biber 44 0%
#1,034 teleport 44 0%
#1,035 shivammathur/php/php@8.6 44 0%
#1,036 bl4cc4t/vsplugins/vsp-znedi3 --HEAD 44 0%
#1,037 coin-or-tools/coinor/osi 44 0%
#1,038 brewsci/science/gnudatalanguage 44 0%
#1,039 niluje/kindletool/libarchive-git --HEAD 44 0%
#1,040 xyzzy42/horology/tg-timer --HEAD 44 0%
#1,041 mediaarea/mediaarea/ffmpeg-ma 44 0%
#1,042 orchard-robotics/macos-tailscale-installer/trayscale 44 0%
#1,043 neomutt 44 0%
#1,044 freetds 44 0%
#1,045 solana 43 0%
#1,046 shfmt 43 0%
#1,047 mysql@5.7 43 0%
#1,048 subfinder 43 0%
#1,049 lld 43 0%
#1,050 libfuse 43 0%
#1,051 iptux-src/iptux/iptux 43 0%
#1,052 macaulay2/tap/fflas-ffpack 43 0%
#1,053 qt@5 43 0%
#1,054 moonbase59/tap/loudgain --HEAD 43 0%
#1,055 osrf/simulation/gz-sensors8 43 0%
#1,056 vite-plus 43 0%
#1,057 git-crypt 43 0%
#1,058 harmonybrew/core/llvm 43 0%
#1,059 nwchem 43 0%
#1,060 pyside 43 0%
#1,061 osv-scanner 43 0%
#1,062 go --HEAD 43 0%
#1,063 mono0926/license-plist/license-plist 43 0%
#1,064 nexttrace 42 0%
#1,065 aarch64-elf-gcc 42 0%
#1,066 nmap --HEAD 42 0%
#1,067 libtasn1 42 0%
#1,068 idleberg/asahi/dent 42 0%
#1,069 fnm 42 0%
#1,070 krishjainx/virt-manager/virt-viewer 42 0%
#1,071 gpac 42 0%
#1,072 libslirp 42 0%
#1,073 c-ares 42 0%
#1,074 dovecot 42 0%
#1,075 neelashkannan/tap/usage-touchbar 42 0%
#1,076 harmonybrew/core/emydsvn 42 0%
#1,077 malpern/tap/sketchybar-toggle 42 0%
#1,078 asmvik/formulae/skhd 42 0%
#1,079 txikijs 42 0%
#1,080 chezmoi 42 0%
#1,081 brewsci/bio/sdsl-lite 41 0%
#1,082 dvc 41 0%
#1,083 xxhash 41 0%
#1,084 clingo 41 0%
#1,085 huggingface-cli 41 0%
#1,086 dwcaress/mbsystem/mbsystem 41 0%
#1,087 osrf/simulation/gz-msgs10 41 0%
#1,088 help2man 41 0%
#1,089 macaulay2/tap/givaro 41 0%
#1,090 minio 41 0%
#1,091 elmercsc/elmerfem/elmer --without-mumps 41 0%
#1,092 vice 41 0%
#1,093 yamllint 41 0%
#1,094 elastic/tap/ecctl 41 0%
#1,095 nim 41 0%
#1,096 rubberband 40 0%
#1,097 ice 40 0%
#1,098 little-cms2 40 0%
#1,099 kapacitor 40 0%
#1,100 homebrew-zathura/zathura/zathura --HEAD --with-synctex 40 0%
#1,101 mas 40 0%
#1,102 zeroc-ice/tap/icetouch@3.6 40 0%
#1,103 denji/nginx/nginx-full --with-njs-module 40 0%
#1,104 swftools 40 0%
#1,105 pothosware/pothos/limesuite 40 0%
#1,106 arkime/arkime/arkime 40 0%
#1,107 ethereum 40 0%
#1,108 geos 39 0%
#1,109 dilumaluthge/tap/platypus 39 0%
#1,110 colmap 39 0%
#1,111 afflib 39 0%
#1,112 aritya-arjunan/cmix/cmix 39 0%
#1,113 bear 39 0%
#1,114 vfox 39 0%
#1,115 daavid00/opm/resinsight 39 0%
#1,116 llvm --HEAD 39 0%
#1,117 buildio/cli/bld 39 0%
#1,118 coin-or-tools/coinor/coinutils 39 0%
#1,119 raybytes/chatmock/chatmock 39 0%
#1,120 sichengchen/tap/apple-calendar-cli 39 0%
#1,121 adb-enhanced 39 0%
#1,122 mono 39 0%
#1,123 nats-server 39 0%
#1,124 proxmark/proxmark3/proxmark3 --HEAD 39 0%
#1,125 salilab/salilab/modeller 39 0%
#1,126 stoken 38 0%
#1,127 go-task 38 0%
#1,128 lsyncd 38 0%
#1,129 ivanopcode/csk/cocoaskills 38 0%
#1,130 mosquitto 38 0%
#1,131 container 38 0%
#1,132 mesa --HEAD 38 0%
#1,133 midnight-commander 38 0%
#1,134 media-info 38 0%
#1,135 luv 38 0%
#1,136 setiastro/setiastrosuitepro/saspro 38 0%
#1,137 nasm 38 0%
#1,138 fernandotcl/fernandotcl/monkeys-audio 38 0%
#1,139 libgcrypt 38 0%
#1,140 openconnect --HEAD 38 0%
#1,141 profanity 38 0%
#1,142 fzj-jsc/scalasca/cubegui 38 0%
#1,143 fi-153/tap/wyoming-apple-stt 38 0%
#1,144 dartsim 38 0%
#1,145 openscad/tap/lib3mf 38 0%
#1,146 openclaw-cli 38 0%
#1,147 lynx 38 0%
#1,148 ktemkin/oss-fpga/nextpnr-ice40 --HEAD 37 0%
#1,149 kreuzberg-dev/tap/kreuzberg 37 0%
#1,150 shaka-packager 37 0%
#1,151 m68k-elf-gcc 37 0%
#1,152 httpx 37 0%
#1,153 simpsonjulian/statica-tap/statica 37 0%
#1,154 manicmaniac/tap/class-dump 37 0%
#1,155 ivandokov/contrib/phockup 37 0%
#1,156 aws/tap/lightsailctl 37 0%
#1,157 md4c 37 0%
#1,158 ktemkin/oss-fpga/project-trellis --HEAD 37 0%
#1,159 opencolorio 37 0%
#1,160 datadog/lapdog/lapdog 37 0%
#1,161 mtg/essentia/essentia --HEAD --without-python 37 0%
#1,162 knazarov/qemu-virgl/qemu-virgl 37 0%
#1,163 atuin 37 0%
#1,164 re2 37 0%
#1,165 duplocloud/tap/duploctl --with-pip 37 0%
#1,166 etcd 37 0%
#1,167 gmerlino/exfat/exfat --HEAD 37 0%
#1,168 yaml-cpp 37 0%
#1,169 kolontsov/fxload/fxload 37 0%
#1,170 fpc 37 0%
#1,171 jq 37 0%
#1,172 libimobiledevice-glue --HEAD 36 0%
#1,173 gcenx/apple/game-porting-toolkit 36 0%
#1,174 freeswitch 36 0%
#1,175 ffmpeg@7 36 0%
#1,176 smake 36 0%
#1,177 appium 36 0%
#1,178 spice-gtk 36 0%
#1,179 autoconf 36 0%
#1,180 macaulay2/tap/eantic 36 0%
#1,181 brewsci/bio/ambertools 36 0%
#1,182 libewf --HEAD 36 0%
#1,183 suite-sparse 36 0%
#1,184 lizardbyte/homebrew/sunshine --HEAD 36 0%
#1,185 sqitchers/sqitch/sqitch --with-snowflake-support 36 0%
#1,186 liudangyi/i386-jos-elf-gcc/i386-jos-elf-gcc 36 0%
#1,187 osx-cross/arm/arm-none-eabi-gcc@8 36 0%
#1,188 libfuse@2 36 0%
#1,189 harmonybrew/core/libsecret 36 0%
#1,190 smartloop-ai/smartloop/smartloop 36 0%
#1,191 cataclysm --HEAD 35 0%
#1,192 pyinstaller 35 0%
#1,193 osrf/simulation/gz-common5 35 0%
#1,194 osrf/simulation/gz-sim8 35 0%
#1,195 yoggy/tap/oscpack 35 0%
#1,196 osrm-backend 35 0%
#1,197 fairrootgroup/fairsoft/fairsoft 35 0%
#1,198 macmade/tap/trash --HEAD 35 0%
#1,199 merve 35 0%
#1,200 croc 35 0%
#1,201 gastown --HEAD 35 0%
#1,202 nutcracker/tap/openssl@1.0 35 0%
#1,203 oh-my-posh 35 0%
#1,204 kojix2/brew/deepl-cli 35 0%
#1,205 jrsonnet 35 0%
#1,206 tornupnegatives/tap/tmsexpress 35 0%
#1,207 elicollinson/solenoid/solenoid 35 0%
#1,208 nettle 35 0%
#1,209 flexget 35 0%
#1,210 konjoai/squish/squish 35 0%
#1,211 coder 35 0%
#1,212 bootoption/repo/bootoption 35 0%
#1,213 alyraffauf/tap/atbbs 35 0%
#1,214 signal-cli 35 0%
#1,215 libaec 35 0%
#1,216 payload-dumper-go 35 0%
#1,217 incom-0/incom/incplot 35 0%
#1,218 vllm 35 0%
#1,219 flypenguin/okta-cli/okta-cli 34 0%
#1,220 designbynumbers/cantarellalab/knoodle 34 0%
#1,221 stockfish 34 0%
#1,222 pothosware/pothos/soapyhackrf 34 0%
#1,223 rdp/openssh-gssapi/openssh-patched 34 0%
#1,224 named-data/ndn/ndn-cxx 34 0%
#1,225 normen/tap/whatscli 34 0%
#1,226 vulkan-tools 34 0%
#1,227 meunierd/homebrew/amitools 34 0%
#1,228 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-mailutils --with-xwidgets 34 0%
#1,229 mosh 34 0%
#1,230 auto-editor 34 0%
#1,231 riscv64-elf-gcc 34 0%
#1,232 gtk4 34 0%
#1,233 libpq@17 34 0%
#1,234 argocd 34 0%
#1,235 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-librsvg --with-native-comp --with-xwidgets 34 0%
#1,236 crystal-ameba/ameba/ameba 34 0%
#1,237 amrkmn/tap/opencode 34 0%
#1,238 xclogparser 34 0%
#1,239 lima --HEAD 34 0%
#1,240 source-highlight 33 0%
#1,241 elmercsc/elmerfem/elmer 33 0%
#1,242 duane1024/l123/l123 33 0%
#1,243 uvwasi 33 0%
#1,244 zmwangx/npm-noob/noob 33 0%
#1,245 lingtai-ai/lingtai/lingtai-tui 33 0%
#1,246 metaneutrons/tap/amiga-gcc 33 0%
#1,247 neovide 33 0%
#1,248 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick 33 0%
#1,249 puleeno/openlitespeed/openlitespeed 33 0%
#1,250 proselint 33 0%
#1,251 miromannino/tap/git-import-contributions 33 0%
#1,252 influxdb@1 33 0%
#1,253 ntfs-3g 33 0%
#1,254 tifrueh/mytap/md2atxt 33 0%
#1,255 mehdichaouch/airport-bssid/airport-bssid 33 0%
#1,256 thors-mongo 33 0%
#1,257 tehzz/n64-dev/mips-linux-gnu-binutils 33 0%
#1,258 bettercap 33 0%
#1,259 bind 33 0%
#1,260 shader-slang 33 0%
#1,261 k3d 33 0%
#1,262 pc6001vx 32 0%
#1,263 ladybird --HEAD 32 0%
#1,264 brewsci/bio/dssp 32 0%
#1,265 hadolint 32 0%
#1,266 viamrobotics/brews/tensorflowlite 32 0%
#1,267 steipete/tap/imsg 32 0%
#1,268 trunkrecorder/install/gr-osmosdr 32 0%
#1,269 spdlog 32 0%
#1,270 gerlero/openfoam/foamlib 32 0%
#1,271 ataraxy-labs/tap/weave 32 0%
#1,272 tmmamede/private/firebird 32 0%
#1,273 spnavcfg 32 0%
#1,274 moderneinc/moderne/mod --HEAD 32 0%
#1,275 eza 32 0%
#1,276 projectbluefin/bluefinctl/bluefinctl 32 0%
#1,277 apfel 32 0%
#1,278 mariadb@10.11 32 0%
#1,279 octave 32 0%
#1,280 highway 32 0%
#1,281 graph-tool 32 0%
#1,282 openssl@1.1 32 0%
#1,283 kiliankoe/formulae/swift-outdated 32 0%
#1,284 modsecurity 32 0%
#1,285 sops 32 0%
#1,286 shivammathur/extensions/interbase@8.6 31 0%
#1,287 ext4fuse 31 0%
#1,288 python-matplotlib 31 0%
#1,289 saulpw/vd/visidata 31 0%
#1,290 gromgit/fuse/ntfs-3g-mac --HEAD 31 0%
#1,291 dunst 31 0%
#1,292 libsndfile 31 0%
#1,293 mac-vz/tap/macvz 31 0%
#1,294 recmanj-org/ecmwf/ecmwf-toolbox 31 0%
#1,295 hdf5-mpi 31 0%
#1,296 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libaribb24 31 0%
#1,297 brewsci/bio/phyx 31 0%
#1,298 rocq-elpi 31 0%
#1,299 mactop 31 0%
#1,300 ykman 31 0%
#1,301 iina/mpv-iina/ffmpeg-iina 31 0%
#1,302 supabase 31 0%
#1,303 molten-vk --HEAD 31 0%
#1,304 libirecovery 31 0%
#1,305 gum 31 0%
#1,306 milend/taps/hmap 31 0%
#1,307 dnsmasq 31 0%
#1,308 brewsci/bio/circos 31 0%
#1,309 cloud-sql-proxy 31 0%
#1,310 romaintb/terminalist/terminalist 31 0%
#1,311 libgpg-error 31 0%
#1,312 jakehilborn/jakehilborn/displayplacer 30 0%
#1,313 kilinrax/ceph-client/ceph-client 30 0%
#1,314 interline-io/planetutils/osmctools 30 0%
#1,315 soundscaperenderer/ssr/ssr 30 0%
#1,316 bl4cc4t/vsplugins/vsp-nnedi3 --HEAD 30 0%
#1,317 costerwi/calculix/calculix-ccx 30 0%
#1,318 libbtbb 30 0%
#1,319 dmmulroy/tap/jj-starship 30 0%
#1,320 steipete/tap/camsnap 30 0%
#1,321 wabt 30 0%
#1,322 david0/audio/calf 30 0%
#1,323 gifski 30 0%
#1,324 ethereum/ethereum/solidity@5 30 0%
#1,325 mediamtx 30 0%
#1,326 tamarin-prover/tap/tamarin-prover 30 0%
#1,327 dmnc/horology/tg-timer 30 0%
#1,328 facebook/fb/fbsimctl 30 0%
#1,329 btop --HEAD 30 0%
#1,330 zeroc-ice/tap/ice 30 0%
#1,331 herdr --HEAD 30 0%
#1,332 zlib-ng-compat 30 0%
#1,333 liblinear 30 0%
#1,334 s2n 30 0%
#1,335 stek29/idevice/idevicerestore --HEAD 30 0%
#1,336 nginx/unit/php-embed 30 0%
#1,337 hqhq1025/clipaste/clipaste 30 0%
#1,338 isl 30 0%
#1,339 scala-cli 30 0%
#1,340 fredowski/pspp/spread-sheet-widget 30 0%
#1,341 armitage-labs/creem/creem 30 0%
#1,342 proj 30 0%
#1,343 mlx-c 30 0%
#1,344 damask-grid 30 0%
#1,345 endevco/tap/aube 30 0%
#1,346 galenspikes/spatelier/spatelier 30 0%
#1,347 libirecovery --HEAD 30 0%
#1,348 john-jumbo 29 0%
#1,349 node_exporter 29 0%
#1,350 koraysels/personal/zeal --HEAD 29 0%
#1,351 donn/lemon-graph/lemon-graph 29 0%
#1,352 crane 29 0%
#1,353 redhatinsights/bonfire/bonfire 29 0%
#1,354 php --HEAD 29 0%
#1,355 hcavarsan/kftray/kftray --HEAD 29 0%
#1,356 libtensorflow 29 0%
#1,357 vivictorg/vivictpp/vivictpp 29 0%
#1,358 meson 29 0%
#1,359 bpython 29 0%
#1,360 libxcb 29 0%
#1,361 openfpgaloader --HEAD 29 0%
#1,362 railwaycat/emacsmacport/emacs-mac@31exp --HEAD 29 0%
#1,363 julia 29 0%
#1,364 hwangtaehyun/tap/oh-my-agentic-score 29 0%
#1,365 fftw 29 0%
#1,366 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 29 0%
#1,367 dim-gggl/brew/super-pocket 29 0%
#1,368 takesako/sigrok/pulseview 29 0%
#1,369 codejunkie99/ztk/ztk 29 0%
#1,370 0xshug0/audio-cpp/audio-cpp 29 0%
#1,371 ispell 29 0%
#1,372 libdap 29 0%
#1,373 augeas 29 0%
#1,374 libuv --HEAD 29 0%
#1,375 ladybug 29 0%
#1,376 librespeed/tap/librespeed-cli 29 0%
#1,377 swival/tap/swival 29 0%
#1,378 mumps 29 0%
#1,379 fredowski/pspp/pspp --HEAD 28 0%
#1,380 thousandflowers/raccoon/rcc 28 0%
#1,381 libsigrok --HEAD 28 0%
#1,382 ffmpeg-full --HEAD 28 0%
#1,383 bendews/tap/apw 28 0%
#1,384 lc0 28 0%
#1,385 universal-ctags --HEAD 28 0%
#1,386 gcl 28 0%
#1,387 dtnewman/zev/zev 28 0%
#1,388 m-moravcik/viberes/viberes 28 0%
#1,389 spirv-tools 28 0%
#1,390 python-yq 28 0%
#1,391 s3cmd 28 0%
#1,392 d12frosted/emacs-plus/emacs-plus@30 --with-spacemacs-icon 28 0%
#1,393 haiti 28 0%
#1,394 netskopeoss/tap/netskope 28 0%
#1,395 csvkit 28 0%
#1,396 mavsdk 28 0%
#1,397 shaderc 28 0%
#1,398 costerwi/calculix/calculix-cgx 28 0%
#1,399 ctdk/ctdk/bsdgames-osx 28 0%
#1,400 get-engram/engram/engram 28 0%
#1,401 vice --HEAD 28 0%
#1,402 mcs07/cheminformatics/osra 28 0%
#1,403 theharvester 28 0%
#1,404 trojan-gfw/trojan/trojan 28 0%
#1,405 houmain/tap/keymapper --HEAD 28 0%
#1,406 rtabmap 28 0%
#1,407 llvm-mingw64 27 0%
#1,408 testball1 --with-foo 27 0%
#1,409 pothosware/pothos/libad9361 27 0%
#1,410 osx-cross/avr/avarice 27 0%
#1,411 hermes-agent --HEAD 27 0%
#1,412 paradigmxyz/brew/reth 27 0%
#1,413 sidaf/pentest/responder 27 0%
#1,414 max2github/msh/gnat 27 0%
#1,415 age-plugin-se 27 0%
#1,416 harelba/q/q 27 0%
#1,417 libzip 27 0%
#1,418 percona-server 27 0%
#1,419 lthoangg/tap/openagentd 27 0%
#1,420 schappim/ekctl/ekctl 27 0%
#1,421 yara 27 0%
#1,422 freecad/freecad/pyside2@5.15.5 27 0%
#1,423 libngtcp2 27 0%
#1,424 sshfs 27 0%
#1,425 niluje/kindletool/kindletool --HEAD 27 0%
#1,426 silent-lad/vegitate/vegitate 27 0%
#1,427 berkeley-db@5 27 0%
#1,428 mariadb@11.4 27 0%
#1,429 openfpgaloader 27 0%
#1,430 libplacebo 27 0%
#1,431 iotaledger/tap/iota 27 0%
#1,432 libarchive 27 0%
#1,433 ddev/ddev/ddev --HEAD 27 0%
#1,434 glew 27 0%
#1,435 harmonybrew/core/llvm@22 27 0%
#1,436 morantron/tmux-fingers/tmux-fingers 27 0%
#1,437 ozeias/postgresql/postgresql@15 27 0%
#1,438 petere/postgresql/postgresql@9.5 27 0%
#1,439 thors-anvil 27 0%
#1,440 fd 27 0%
#1,441 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 27 0%
#1,442 gcc@13 27 0%
#1,443 xenodium/evertime/evertime --HEAD 27 0%
#1,444 kenshaw/iv/iv 27 0%
#1,445 digital-chemistry-laboratory/multiwfn/multiwfn --HEAD 27 0%
#1,446 makensis 27 0%
#1,447 hashcat 26 0%
#1,448 agda 26 0%
#1,449 hledger 26 0%
#1,450 gildas/tap/bitbucket-cli 26 0%
#1,451 csound 26 0%
#1,452 render 26 0%
#1,453 gnu-getopt 26 0%
#1,454 mrklein/foam/scotch 26 0%
#1,455 shivammathur/php/php@8.6-debug-zts 26 0%
#1,456 mysql@9.7 26 0%
#1,457 tree-sitter 26 0%
#1,458 restic 26 0%
#1,459 cartman-kai/thrift/thrift@0.11 26 0%
#1,460 harmonybrew/core/amqp-cpp 26 0%
#1,461 arlol/tap/newlinechecker 26 0%
#1,462 pixman 26 0%
#1,463 rtulke/airsnare/airsnare 26 0%
#1,464 nnstreamer/neural-network/nnstreamer 26 0%
#1,465 niluje/kindletool/kindletool 26 0%
#1,466 nextpnr-ice40 --HEAD 26 0%
#1,467 bandicoot 26 0%
#1,468 dlr-ts/sumo/sumo 26 0%
#1,469 mediaarea/mediaarea/ffmpeg-ma --with-iec61883 26 0%
#1,470 mlx-lm 26 0%
#1,471 nat-n/poethepoet/poethepoet 26 0%
#1,472 promptfoo 26 0%
#1,473 anubis 26 0%
#1,474 carlosedp/tap/sshoot 26 0%
#1,475 rtmpdump 26 0%
#1,476 mgba 26 0%
#1,477 firefoxpwa 26 0%
#1,478 osrf/simulation/gz-rendering8 26 0%
#1,479 htslib 26 0%
#1,480 ipython 26 0%
#1,481 gdu 26 0%
#1,482 sqitchers/sqitch/sqitch --with-mysql-support 26 0%
#1,483 qmk/qmk/qmk 26 0%
#1,484 emgeorrk/tap/pulse 26 0%
#1,485 renesenses/tap/tune-server 26 0%
#1,486 syft 26 0%
#1,487 sidaf/pentest/dnsrecon 26 0%
#1,488 laserkats/taps/maplibre 26 0%
#1,489 libguestfs 26 0%
#1,490 allen-ball/tap/dovecot@2.3 26 0%
#1,491 d12frosted/emacs-plus/emacs-plus@32 --with-xwidgets 26 0%
#1,492 caryll/tap/otfcc-mac64 26 0%
#1,493 periphery 26 0%
#1,494 revylai/tap/greenlight 25 0%
#1,495 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-blueshark 25 0%
#1,496 kabel/pecl/php-igbinary 25 0%
#1,497 guile 25 0%
#1,498 criterion 25 0%
#1,499 rig-r 25 0%
#1,500 unxip 25 0%
#1,501 vcpkg 25 0%
#1,502 tree 25 0%
#1,503 v8@3.15 25 0%
#1,504 namelocmas/mipsel-none-elf-gcc/mipsel-none-elf-binutils 25 0%
#1,505 tor 25 0%
#1,506 johnhcc/gs-x11/ghostscript-x11 25 0%
#1,507 gmsh 25 0%
#1,508 sfml 25 0%
#1,509 cartman-kai/thrift/thrift@0.9 25 0%
#1,510 kubo 25 0%
#1,511 binaryen 25 0%
#1,512 atopile/tap/atopile 25 0%
#1,513 martinpaljak/brew/gppro --HEAD 25 0%
#1,514 wget --HEAD 25 0%
#1,515 borgbackup 25 0%
#1,516 python-gdbm@3.14 25 0%
#1,517 cfergeau/crc/crc 25 0%
#1,518 sidaf/pentest/wafw00f 25 0%
#1,519 core-lightning 25 0%
#1,520 gopls 25 0%
#1,521 jqueguiner/whatsapp-desktop-mcp/whatsapp-desktop-mcp 25 0%
#1,522 harmonybrew/core/codex 25 0%
#1,523 cloudamqp/cloudamqp/lavinmq 25 0%
#1,524 mypy 25 0%
#1,525 sleuthkit 25 0%
#1,526 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-mailutils --with-xwidgets 25 0%
#1,527 shivammathur/php/php@8.6-debug 25 0%
#1,528 osrf/simulation/gz-msgs12 25 0%
#1,529 wrf-cmake/wrf/wrf-cmake 25 0%
#1,530 pg_cron 25 0%
#1,531 ethereum/ethereum/solidity 25 0%
#1,532 maigret 25 0%
#1,533 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libplacebo 24 0%
#1,534 gtk-doc 24 0%
#1,535 kustomize 24 0%
#1,536 shivammathur/php/php@8.6-zts 24 0%
#1,537 hey 24 0%
#1,538 mpryor/tap/nless 24 0%
#1,539 pg_partman 24 0%
#1,540 admesh/admesh/stlsplit 24 0%
#1,541 mpd 24 0%
#1,542 d12frosted/emacs-plus/emacs-plus@30 --without-cocoa 24 0%
#1,543 rosco-m68k/toolchain/binutils-cross-m68k 24 0%
#1,544 elm 24 0%
#1,545 swift-section 24 0%
#1,546 futuro/brew/cyrus-sasl-xoauth2 --HEAD 24 0%
#1,547 zxing-cpp 24 0%
#1,548 terragrunt 24 0%
#1,549 aws-c-http 24 0%
#1,550 jfrog-cli 24 0%
#1,551 ideviceinstaller --HEAD 24 0%
#1,552 bat 24 0%
#1,553 renode/tap/renode 24 0%
#1,554 influxdb@2 24 0%
#1,555 swig --HEAD 24 0%
#1,556 evil-helix 24 0%
#1,557 cdxgen 24 0%
#1,558 wyattjoh/stable/claude-code-notification 24 0%
#1,559 shopify/shopify/openssl@1.0 24 0%
#1,560 brannala/ba3/ba3 24 0%
#1,561 cosmostat/science/sparse2d 24 0%
#1,562 snaipe/soft/criterion 24 0%
#1,563 ipget 24 0%
#1,564 brewsci/bio/sortmerna 24 0%
#1,565 facebook/fb/buck 24 0%
#1,566 foundry 24 0%
#1,567 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD 24 0%
#1,568 libgeodesk 24 0%
#1,569 zerotier/tap/libzt 24 0%
#1,570 x3270 24 0%
#1,571 fastlane 24 0%
#1,572 laurentftech/ntfy-macos/ntfy-macos 24 0%
#1,573 pgcli 24 0%
#1,574 harmonybrew/core/dotnet 23 0%
#1,575 redox-os/gcc_cross_compilers/x86_64-elf-gcc 23 0%
#1,576 sdl2_mixer 23 0%
#1,577 exo-explore/exo/exo 23 0%
#1,578 samba 23 0%
#1,579 crip 23 0%
#1,580 ootrandomizer/tap/n64 --HEAD 23 0%
#1,581 rgbds --HEAD 23 0%
#1,582 sfcgal 23 0%
#1,583 edbrowse 23 0%
#1,584 go@1.26 23 0%
#1,585 emin017/ghostty/ghostty --HEAD 23 0%
#1,586 akaama/lyrics-display/lyrics-display 23 0%
#1,587 sizeak/tap/claude-commander 23 0%
#1,588 patchpal 23 0%
#1,589 androidzzt/tap/cc-statistics 23 0%
#1,590 meshtastic 23 0%
#1,591 task 23 0%
#1,592 sidaf/pentest/impacket 23 0%
#1,593 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-native-comp 23 0%
#1,594 satococoa/tap/wtp 23 0%
#1,595 beads 23 0%
#1,596 brewsci/bio/emboss 23 0%
#1,597 protobuf@29 23 0%
#1,598 realagiorganization/tap/tether-ai 23 0%
#1,599 vladekk/far2l/far2l-tty-full 23 0%
#1,600 aws-sam-cli 23 0%
#1,601 micromamba 23 0%
#1,602 bbot 23 0%
#1,603 portable-ruby 23 0%
#1,604 d235j/ios-restore-tools/libimobiledevice --HEAD 23 0%
#1,605 pi-coding-agent 23 0%
#1,606 cloudamqp/cloudamqp/amqpcat 23 0%
#1,607 simonw/llm/ttok 23 0%
#1,608 timescale/tap/timescaledb --without-timescaledb-tools 23 0%
#1,609 j-x-z/tap/cocoa-way 23 0%
#1,610 libgoa 23 0%
#1,611 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-xwidgets 23 0%
#1,612 systemmanic/yawsso/yawsso 23 0%
#1,613 dzinin/ccr/ccr 23 0%
#1,614 espeak-ng --HEAD 23 0%
#1,615 zegervdv/zathura/zathura --HEAD 23 0%
#1,616 delph-in/delphin/ace 23 0%
#1,617 whisper-cpp --HEAD 23 0%
#1,618 max2github/msh/ghdl-dev 23 0%
#1,619 wix/brew/applesimutils 23 0%
#1,620 gerbv 23 0%
#1,621 thomasmaerz/virt-manager/libvirt 23 0%
#1,622 osrf/simulation/gz-transport15 23 0%
#1,623 cloudflare/cloudflare/curl --HEAD 22 0%
#1,624 openai-whisper 22 0%
#1,625 omlahore/tap/removemacai 22 0%
#1,626 r-rig 22 0%
#1,627 slp/krunkit/virglrenderer 22 0%
#1,628 ptsochantaris/tap/trailer-cli 22 0%
#1,629 rlwrap 22 0%
#1,630 open-mpi --HEAD 22 0%
#1,631 dailybothq/tap/dailybot 22 0%
#1,632 davidchall/hep/hepmc3 --with-root 22 0%
#1,633 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-mailutils --with-xwidgets 22 0%
#1,634 tcl-tk@8 22 0%
#1,635 brewsci/bio/lofreq 22 0%
#1,636 banagale/filekitty/filekitty 22 0%
#1,637 fvm 22 0%
#1,638 libolm 22 0%
#1,639 bandwagonvibes/fixxer/fixxer 22 0%
#1,640 harmonybrew/core/fontconfig 22 0%
#1,641 brewsci/bio/mash 22 0%
#1,642 act 22 0%
#1,643 gadomski/gadomski/fgt 22 0%
#1,644 chapel 22 0%
#1,645 cloud-v/icestorm/nextpnr-ice40 22 0%
#1,646 black 22 0%
#1,647 yurikoles/yurikoles/far2l --HEAD 22 0%
#1,648 lawrencecurtis/local-vmaf/libvmaf 22 0%
#1,649 d12frosted/emacs-plus/emacs-plus@29 --with-modern-icon --with-native-comp 22 0%
#1,650 cangjie 22 0%
#1,651 sqlcmd 22 0%
#1,652 xapian 22 0%
#1,653 brewsci/bio/famsa 22 0%
#1,654 dilumaluthge-packaging/tap/shyaml-rs 22 0%
#1,655 spectolabs/tap/hoverfly 22 0%
#1,656 nile-agi/delta-cli/delta-cli --HEAD 22 0%
#1,657 zellij 22 0%
#1,658 helics 22 0%
#1,659 d12frosted/emacs-plus/emacs-plus@30 --with-modern-doom-icon 22 0%
#1,660 d12frosted/emacs-plus/emacs-plus@30 --with-modern-doom3-icon 22 0%
#1,661 d12frosted/emacs-plus/emacs-plus@30 --with-modern-icon 22 0%
#1,662 codefresh-io/cli/cf2 22 0%
#1,663 arthur-ficial/tap/apfel-mcp 22 0%
#1,664 ruimarinho/tap/gsts 22 0%
#1,665 localai 22 0%
#1,666 siege 22 0%
#1,667 theapplegates/kleopatra6mac/libkleo 22 0%
#1,668 micro 22 0%
#1,669 realagiorganization/tap/tether-ai-rc 22 0%
#1,670 guiguem/tap/geant4@10.3 22 0%
#1,671 swiftly 22 0%
#1,672 filebrowser 22 0%
#1,673 x11vnc 22 0%
#1,674 nushell 21 0%
#1,675 avoidik/qemu-spice/libepoxy-egl 21 0%
#1,676 andrewtriestocode/brews/bg3mfx 21 0%
#1,677 petere/postgresql/postgresql@9.6 21 0%
#1,678 chafa 21 0%
#1,679 iceman1001/proxmark3/proxmark3 21 0%
#1,680 ankitsharma26/tools/iwf-server 21 0%
#1,681 haskell-stack 21 0%
#1,682 seezatnap/seezatnap/swarm 21 0%
#1,683 jaredwideman/virt-manager/virt-viewer 21 0%
#1,684 gabrimatic/local-whisper/local-whisper 21 0%
#1,685 nsq 21 0%
#1,686 openj9 21 0%
#1,687 tailcat 21 0%
#1,688 kea 21 0%
#1,689 darkice 21 0%
#1,690 mxlgv/dino/dino 21 0%
#1,691 kaito-tokyo/kaito-tokyo/mumble-server 21 0%
#1,692 dockutil 21 0%
#1,693 unzip 21 0%
#1,694 piti-diablotin/tap/agate 21 0%
#1,695 glslang 21 0%
#1,696 vercel-cli 21 0%
#1,697 pyenv 21 0%
#1,698 jydu/biopp/libbpp-core 21 0%
#1,699 goldziher/tap/kreuzberg 21 0%
#1,700 w3m 21 0%
#1,701 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-imagemagick --with-librsvg --with-native-comp --with-natural-title-bar --with-xwidgets 21 0%
#1,702 sigrok-cli --HEAD 21 0%
#1,703 afonsofrancof/taps/biber@2.17 21 0%
#1,704 darelover/ntfs-3g/ntfs-3g 21 0%
#1,705 jupyterlab 21 0%
#1,706 arb-project/arb/arb@7 --HEAD 21 0%
#1,707 ashuttl/linecast/linecast 21 0%
#1,708 jayfarei/opentraces/opentraces 21 0%
#1,709 osrf/simulation/gz-gui8 21 0%
#1,710 dagu 21 0%
#1,711 tfcollins/formulae/iio-oscilloscope 21 0%
#1,712 dagger 21 0%
#1,713 mcs07/cheminformatics/open-babel 21 0%
#1,714 portable-openssl 21 0%
#1,715 dciabrin/ngdevkit/ngdevkit-toolchain 21 0%
#1,716 mariadb@10.6 21 0%
#1,717 dive 21 0%
#1,718 opus 21 0%
#1,719 amar1729/formulae/browserpass 21 0%
#1,720 libsoxr 21 0%
#1,721 narbs/tap/narbs-ptui 21 0%
#1,722 or-tools 21 0%
#1,723 cppcheck 21 0%
#1,724 pcb2gcode 21 0%
#1,725 aptos 21 0%
#1,726 nvi2 21 0%
#1,727 pyqt 21 0%
#1,728 botan 21 0%
#1,729 tiger-vnc 21 0%
#1,730 libextractor --HEAD 21 0%
#1,731 jackett 21 0%
#1,732 conan 21 0%
#1,733 audivir/repo/bindfs-fuse-t 21 0%
#1,734 sheurich/tap/boulder 21 0%
#1,735 graalvm 21 0%
#1,736 batt 21 0%
#1,737 suricata 21 0%
#1,738 drbenmorgan/geant4/geant4 20 0%
#1,739 sysbench --HEAD 20 0%
#1,740 showxu/tap/cartool 20 0%
#1,741 homebrew-ntfs-3g --HEAD 20 0%
#1,742 ldns 20 0%
#1,743 vmware-tanzu/pinniped/pinniped-cli 20 0%
#1,744 kackerx/tap/sqlmux 20 0%
#1,745 elmercsc/elmerfem/elmer --with-elmergui --without-mumps 20 0%
#1,746 whisper.cpp 20 0%
#1,747 jamescrake-merani/tap/auto-timesheet 20 0%
#1,748 scdl 20 0%
#1,749 dart-sass 20 0%
#1,750 cartman-kai/thrift/thrift@0.20 20 0%
#1,751 shivammathur/php/php@7.0 20 0%
#1,752 trojan-go 20 0%
#1,753 steveyegge/beads/bd 20 0%
#1,754 ddvtech/mistserver/mistserver 20 0%
#1,755 bl4cc4t/vsplugins/vsp-nnedi3cl --HEAD 20 0%
#1,756 pothosware/pothos/libosmosdr --HEAD 20 0%
#1,757 yangl900/armclient-go/armclient-go 20 0%
#1,758 siril 20 0%
#1,759 fcp 20 0%
#1,760 solidity 20 0%
#1,761 imlib2 20 0%
#1,762 pascaliske/libbpg/libbpg-stable 20 0%
#1,763 neved4/tap/dnsenum2 20 0%
#1,764 kunichiko/tap/mono2stereo 20 0%
#1,765 asafrose/agent-slack/agent-slack 20 0%
#1,766 xmrig 20 0%
#1,767 anyquery 20 0%
#1,768 kojix2/brew/wgsim 20 0%
#1,769 ttyd 20 0%
#1,770 vldmrkl/formulae/airdrop-cli 20 0%
#1,771 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac 20 0%
#1,772 seqkit 20 0%
#1,773 makim 20 0%
#1,774 nativeos/i386-elf-toolchain/i386-elf-grub 20 0%
#1,775 harlequin 20 0%
#1,776 woshiccm/tap/pecker 20 0%
#1,777 frosit/mysql/mysql@5.7 20 0%
#1,778 pyqt@5 20 0%
#1,779 obverser/zathura/zathura 20 0%
#1,780 motemen/furoshiki2/furoshiki2 --HEAD 20 0%
#1,781 vapoursynth-mlrt 20 0%
#1,782 freetds --HEAD 20 0%
#1,783 davea/perlmagick/perlmagick 20 0%
#1,784 aws-vault 20 0%
#1,785 gisogrimm/tap/tascar 20 0%
#1,786 x265 --HEAD 20 0%
#1,787 thefox/brewery/cmus-control 20 0%
#1,788 johntrandall/tap/mcp-omniplan-jtr 20 0%
#1,789 libcbor 20 0%
#1,790 emscripten 20 0%
#1,791 ethereum/ethereum/solidity@4 20 0%
#1,792 homebrew-zathura/zathura/zathura-pdf-poppler 20 0%
#1,793 d12frosted/emacs-plus/emacs-plus@32 --with-dbus --with-debug --with-mailutils --with-xwidgets 20 0%
#1,794 william-ger/typer/typer 20 0%
#1,795 plakar 20 0%
#1,796 ipatool --HEAD 19 0%
#1,797 istioctl 19 0%
#1,798 privoxy 19 0%
#1,799 getagentseal/codeburn/codeburn 19 0%
#1,800 jguida941/voiceterm/voiceterm 19 0%
#1,801 foo 19 0%
#1,802 petere/postgresql/postgresql@11 19 0%
#1,803 libnghttp3 19 0%
#1,804 magika 19 0%
#1,805 llvm@19 19 0%
#1,806 aws-crt-cpp 19 0%
#1,807 harmonybrew/core/util-linux 19 0%
#1,808 gallery-dl 19 0%
#1,809 barnardb/cookies/cookies 19 0%
#1,810 amass 19 0%
#1,811 monitoring-plugins 19 0%
#1,812 zircote/tap/git-adr 19 0%
#1,813 e0da/e0da/plocate 19 0%
#1,814 block-goose-cli 19 0%
#1,815 global 19 0%
#1,816 ideviceinstaller 19 0%
#1,817 dtjm/taps/bible 19 0%
#1,818 libass 19 0%
#1,819 docker-credential-helper 19 0%
#1,820 alejoborbo/tap/jj-spice 19 0%
#1,821 yurikoles/yurikoles/far2l 19 0%
#1,822 harmonybrew/core/chipmunk-physics 19 0%
#1,823 fex-emu 19 0%
#1,824 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-dbus --with-imagemagick --with-mailutils --with-modern-icon-purple --with-tree-sitter --with-xwidgets 19 0%
#1,825 wstunnel 19 0%
#1,826 fdroidserver 19 0%
#1,827 martin 19 0%
#1,828 lizardbyte/homebrew/sunshine --with-cuda 19 0%
#1,829 supermodel 19 0%
#1,830 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libdvdnav --with-libdvdread 19 0%
#1,831 mosra/magnum/magnum --HEAD 19 0%
#1,832 protoc-gen-grpc-swift 19 0%
#1,833 mlx-lm --HEAD 19 0%
#1,834 sidaf/pentest/crackmapexec 19 0%
#1,835 remote-cli/remote/remote 19 0%
#1,836 mu 19 0%
#1,837 arlol/tap/chorito 19 0%
#1,838 librealsense 19 0%
#1,839 ekrich/tools/accelerate-lapacke 19 0%
#1,840 ceres-solver 19 0%
#1,841 git-delta 19 0%
#1,842 run-llama/liteparse/llamaindex-liteparse 19 0%
#1,843 ztomer/tap/multitop 19 0%
#1,844 alpine 19 0%
#1,845 fonttools 19 0%
#1,846 sdl2_ttf 19 0%
#1,847 cryptominisat 19 0%
#1,848 gwyddion 19 0%
#1,849 brewsci/bio/pullseq 19 0%
#1,850 percona-server@8.0 19 0%
#1,851 orangewolf/hermes-agent/hermes-agent 19 0%
#1,852 isync 19 0%
#1,853 soilros/opm/resinsight 19 0%
#1,854 vis 19 0%
#1,855 vinn-ie/openems/qcsxcad 19 0%
#1,856 anchor 19 0%
#1,857 joern 19 0%
#1,858 mupdf --HEAD 18 0%
#1,859 texlive 18 0%
#1,860 transmission-cli 18 0%
#1,861 fzj-jsc/scalasca/cubelib 18 0%
#1,862 osrf/simulation/gz-sensors10 18 0%
#1,863 protobuf-c 18 0%
#1,864 vthoang/cgminer/cgminer 18 0%
#1,865 easy-tag 18 0%
#1,866 typst --HEAD 18 0%
#1,867 programmablemd/packages/spry 18 0%
#1,868 jjang-ai/jangq/jang 18 0%
#1,869 zelatrixx/libvips/libheif@1.21.2 18 0%
#1,870 ngscopeclient/ngscopeclient/ngscopeclient --HEAD 18 0%
#1,871 ios-deploy --HEAD 18 0%
#1,872 fswatch 18 0%
#1,873 openium/formula/imagemagick-librsvg 18 0%
#1,874 tbvdm/tap/sigtop --HEAD 18 0%
#1,875 eko/tap/monday 18 0%
#1,876 aconchillo/guile/guile-ncurses 18 0%
#1,877 vangie/formula/douyin-transcriber 18 0%
#1,878 libdvdcss 18 0%
#1,879 watch 18 0%
#1,880 mongo-c-driver 18 0%
#1,881 manim 18 0%
#1,882 grimme-lab/qc/dftd4 18 0%
#1,883 ivan-volnov/tap/keybr 18 0%
#1,884 emqx 18 0%
#1,885 llmfit 18 0%
#1,886 camlp5 18 0%
#1,887 d12frosted/emacs-plus/emacs-plus@31 --with-mailutils --with-xwidgets 18 0%
#1,888 opam 18 0%
#1,889 owntracks/recorder/recorder 18 0%
#1,890 eccodes 18 0%
#1,891 benswift/tap/isync 18 0%
#1,892 kaoh/globalplatform/globalplatform 18 0%
#1,893 kabel/pecl/php-imagick 18 0%
#1,894 bigquery-emulator 18 0%
#1,895 mschulkind-oss/tap/vantage-md 18 0%
#1,896 lambdaclass/tap/ethrex 18 0%
#1,897 bowtie-json-schema/tap/bowtie 18 0%
#1,898 devwhodevs/tap/engraph 18 0%
#1,899 oterm 18 0%
#1,900 libadwaita 18 0%
#1,901 mariadb-connector-c 18 0%
#1,902 unisonlang 18 0%
#1,903 libre 18 0%
#1,904 brewsci/bio/pandaseq 18 0%
#1,905 harmonybrew/core/openssh 18 0%
#1,906 meilisearch 18 0%
#1,907 lucuma13/dit/triplecheck 18 0%
#1,908 spandsp 18 0%
#1,909 awemorris/suika3/suika3 18 0%
#1,910 danielbayley/adobe/idml2docbook 18 0%
#1,911 sysdig 18 0%
#1,912 aws/tap/aws-ddbsh 18 0%
#1,913 frida 18 0%
#1,914 waynehoover/tap/pbrich 18 0%
#1,915 showwin/speedtest/speedtest 18 0%
#1,916 railwaycat/emacsmacport/emacs-mac@30exp 18 0%
#1,917 ruya-ai/cozempic/cozempic 18 0%
#1,918 rgbds 18 0%
#1,919 openssl@3.0 18 0%
#1,920 vsview 17 0%
#1,921 socat 17 0%
#1,922 krish-sysadmin/virt-manager/virt-viewer 17 0%
#1,923 oras 17 0%
#1,924 emmercm/igir/igir 17 0%
#1,925 cssr-tools/opm/opm-common 17 0%
#1,926 d12frosted/emacs-plus/emacs-plus@30 --with-mailutils --with-xwidgets 17 0%
#1,927 libmnl 17 0%
#1,928 echidna 17 0%
#1,929 railwaycat/emacsmacport/emacs-mac@29 --with-no-title-bars 17 0%
#1,930 sing-box --HEAD 17 0%
#1,931 retdec 17 0%
#1,932 sequoia-sq 17 0%
#1,933 sequoia-chameleon-gnupg 17 0%
#1,934 renode/tap/renode --HEAD 17 0%
#1,935 firebase-cli 17 0%
#1,936 gobuster 17 0%
#1,937 sane-backends 17 0%
#1,938 avoidik/qemu-spice/libepoxy-egl --HEAD 17 0%
#1,939 lvillani/tap/carthage-copy-frameworks 17 0%
#1,940 aws-c-io 17 0%
#1,941 sequoia-sqv 17 0%
#1,942 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-mailutils --with-xwidgets 17 0%
#1,943 nativeos/i386-elf-toolchain/i386-elf-gcc 17 0%
#1,944 ncdu 17 0%
#1,945 vitess 17 0%
#1,946 ladislavb/therion/therion 17 0%
#1,947 harmonybrew/core/antlr4-cpp-runtime 17 0%
#1,948 hawk/hawk/lux 17 0%
#1,949 jupytext 17 0%
#1,950 opencv@4 17 0%
#1,951 awscurl 17 0%
#1,952 libredwg 17 0%
#1,953 openshift-cli 17 0%
#1,954 megatools 17 0%
#1,955 exercism 17 0%
#1,956 ola 17 0%
#1,957 lawrencecurtis/tap/ffmpeg 17 0%
#1,958 chrome-cli 17 0%
#1,959 domcyrus/rustnet/rustnet 17 0%
#1,960 rexx-org/rexx-org/rexxsql-lite 17 0%
#1,961 llhttp 17 0%
#1,962 cloudflare/cloudflare/kitesurf 17 0%
#1,963 arlol/tap/git-dora-lead-time-calculator 17 0%
#1,964 mlkit 17 0%
#1,965 dumpling 17 0%
#1,966 brewsci/bio/rapidnj 17 0%
#1,967 aws/aws/amazon-efs-utils 17 0%
#1,968 tyhal/tap/gotraceui 17 0%
#1,969 mosh --HEAD 17 0%
#1,970 up9inc/repo/mockintosh 17 0%
#1,971 stp 17 0%
#1,972 ike-scan 17 0%
#1,973 rawdog 17 0%
#1,974 libtorrent-rasterbar 17 0%
#1,975 neved4/tap/fcron 17 0%
#1,976 nwoolls/xgminer/bfgminer --HEAD 17 0%
#1,977 veracode/tap/gen-ir 17 0%
#1,978 httrack 17 0%
#1,979 surelog 17 0%
#1,980 lefthook 17 0%
#1,981 edanflame/tap/chocotrade 17 0%
#1,982 mhanberg/tap/lazyasdf 17 0%
#1,983 taglib 17 0%
#1,984 dosbox-x 17 0%
#1,985 amiaopensource/amiaos/grabbags 17 0%
#1,986 zoxide 17 0%
#1,987 gitversion 17 0%
#1,988 grimme-lab/qc/multicharge 17 0%
#1,989 harmonybrew/core/gcc 17 0%
#1,990 harmonybrew/core/bzip2 17 0%
#1,991 openemv/tap/dukpt 17 0%
#1,992 binwalk --HEAD 17 0%
#1,993 mikhailai/misc/usbutils 17 0%
#1,994 nathan-v/aws-okta-keyman/aws_okta_keyman 17 0%
#1,995 shairport-sync 17 0%
#1,996 nickswink/macos-test/c0rnbread 17 0%
#1,997 osrf/simulation/sdformat14 17 0%
#1,998 fish-shell/fish-beta-4/fish 17 0%
#1,999 sidaf/pentest/cowpatty 17 0%
#2,000 mkvtoolnix 17 0%
#2,001 zookeeper 17 0%
#2,002 clisp 16 0%
#2,003 agent-browser 16 0%
#2,004 secondcoolestguy/bolma/bolma 16 0%
#2,005 assafwoo/pandafilter/pandafilter 16 0%
#2,006 d99kris/nchat/nchat --without-whatsapp 16 0%
#2,007 orc 16 0%
#2,008 joachimbrindeau/ccusage-monitor/ccusage-monitor 16 0%
#2,009 pike 16 0%
#2,010 mcp-toolbox 16 0%
#2,011 moarvm 16 0%
#2,012 arlol/tap/wait-for-ports 16 0%
#2,013 camfort/camfort/camfort 16 0%
#2,014 semantic-reasoning/tap/wyrelog 16 0%
#2,015 postgrest 16 0%
#2,016 alsa-lib 16 0%
#2,017 taglib --HEAD 16 0%
#2,018 patricktcoakley/formulae/fgvm 16 0%
#2,019 brpc 16 0%
#2,020 lf 16 0%
#2,021 duf 16 0%
#2,022 python-tk@3.15 16 0%
#2,023 akopdev/formulas/nbcat 16 0%
#2,024 redis@6.2 16 0%
#2,025 rust --HEAD 16 0%
#2,026 gnu-sed 16 0%
#2,027 shivammathur/extensions/newrelic@8.2 16 0%
#2,028 brewsci/bio/metabat 16 0%
#2,029 kubectx 16 0%
#2,030 acl2 16 0%
#2,031 ejdb 16 0%
#2,032 emeryberger/scalene/scalene 16 0%
#2,033 qemu@7.2.0 16 0%
#2,034 ramarivera/tap/wacli 16 0%
#2,035 yuitosato/gh-asset/gh-asset 16 0%
#2,036 gpsd 16 0%
#2,037 youtubedr 16 0%
#2,038 fraluc06/ffmpeg-svt-av1-essential/ffmpeg-custom 16 0%
#2,039 spirv-cross 16 0%
#2,040 cikichen/cliproxyapi/cliproxyapi 16 0%
#2,041 runfusion/fusion/fusion 16 0%
#2,042 math-comp 16 0%
#2,043 pgcopydb 16 0%
#2,044 harmonybrew/core/claude-code-router 16 0%
#2,045 gedit 16 0%
#2,046 frei0r 16 0%
#2,047 superstarryeyes/tap/hys 16 0%
#2,048 gnucobol 16 0%
#2,049 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-imagemagick --with-mailutils --with-xwidgets 16 0%
#2,050 adios2 16 0%
#2,051 puckdoug/tap/ico 16 0%
#2,052 chisel-tunnel 16 0%
#2,053 kojix2/brew/verisum 16 0%
#2,054 wayland 16 0%
#2,055 dsandwell/insar/gmtsar 16 0%
#2,056 ublue-os/experimental-tap/rocm-smi-lib 16 0%
#2,057 darwin-containers/formula/bindfs 16 0%
#2,058 skalibs 16 0%
#2,059 openblas64 16 0%
#2,060 designbynumbers/cantarellalab/libplcurve 16 0%
#2,061 fockus/tap/find-skill 16 0%
#2,062 usingcoding/public/apx 16 0%
#2,063 clamav 16 0%
#2,064 lmdb 16 0%
#2,065 osrf/simulation/boost@1.85.0 16 0%
#2,066 pandoc-crossref 16 0%
#2,067 subversion --HEAD 16 0%
#2,068 abinit/tap/agate 16 0%
#2,069 ggshield 16 0%
#2,070 bitomule/tap/koubou 16 0%
#2,071 dilumaluthge/tap/shyaml-rs 16 0%
#2,072 mobile-ar/xcode-assistant-copilot-server/xcode-assistant-copilot-server 16 0%
#2,073 proton-pass-cli 16 0%
#2,074 clickhouse-odbc 16 0%
#2,075 l-smash-works 16 0%
#2,076 zegervdv/zathura/zathura-pdf-poppler 16 0%
#2,077 gastownhall/gascity/gascity 16 0%
#2,078 xorgproto 16 0%
#2,079 qlever-dev/qlever/qlever-control 16 0%
#2,080 webkitgtk 16 0%
#2,081 libsidplayfp 16 0%
#2,082 ansible-lint 16 0%
#2,083 grokj2k 16 0%
#2,084 checkmake 16 0%
#2,085 coreutils --HEAD 16 0%
#2,086 mkdryden/misc/namei 16 0%
#2,087 amiaopensource/amiaos/ffmpegdecklink --with-iec61883 16 0%
#2,088 scalacenter/bloop/bloop 16 0%
#2,089 openssl@3.6 16 0%
#2,090 iamb 16 0%
#2,091 slp/krun/buildah 16 0%
#2,092 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 16 0%
#2,093 aws-c-s3 16 0%
#2,094 b4nst/tap/turbogit 16 0%
#2,095 nejohnson2/sdr/gr-osmosdr --HEAD 16 0%
#2,096 xcbeautify 16 0%
#2,097 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 16 0%
#2,098 brewsci/science/tisean 16 0%
#2,099 duplicity 16 0%
#2,100 vifm 16 0%
#2,101 atari800 16 0%
#2,102 ruby@3.1 16 0%
#2,103 reposurgeon 16 0%
#2,104 steipete/tap/gogcli 16 0%
#2,105 hlrs-vis/tap/adaptivecpp-metal --HEAD 16 0%
#2,106 libpulsar 16 0%
#2,107 alisw/system-deps/bb-storage 16 0%
#2,108 protobuf@33 16 0%
#2,109 libvirt-python 16 0%
#2,110 contribsys/faktory/faktory 15 0%
#2,111 sqlc 15 0%
#2,112 bpytop 15 0%
#2,113 riscv-software-src/riscv/riscv-gnu-toolchain --with-NOmultilib 15 0%
#2,114 libextractor 15 0%
#2,115 vantage-sh/clickhouse/clickhouse@25.6 15 0%
#2,116 tree-sitter-cli 15 0%
#2,117 ajayrmk/tap/trnscrb 15 0%
#2,118 serialosc 15 0%
#2,119 roelofrossouw/sc/simply-cpp-db 15 0%
#2,120 himalaya 15 0%
#2,121 riiid/riiid/toolbelt 15 0%
#2,122 sampsyo/mspgcc/msp430-binutils 15 0%
#2,123 odnoletkov/tap/xcodeproj-format 15 0%
#2,124 ddns-go 15 0%
#2,125 openconnect-gui 15 0%
#2,126 supreme-gg-gg/tap/instagram-cli 15 0%
#2,127 martindelille/tap/qmlfmt 15 0%
#2,128 ezagent42/zchat/zchat --HEAD 15 0%
#2,129 jrmastermodelbuilder/swftools/swftools-head 15 0%
#2,130 node --HEAD 15 0%
#2,131 luvx21/tap/luvx-docker-tags 15 0%
#2,132 mlx --HEAD 15 0%
#2,133 coady/tap/pylucene 15 0%
#2,134 tgtakaoka/msp430-elf/gcc-msp430-elf 15 0%
#2,135 cesanta/mos/mos 15 0%
#2,136 puleeno/openlitespeed/lsphp80 15 0%
#2,137 rtl_433 15 0%
#2,138 rdp/openssh-gssapi/openssh-patched --with-gssapi-support --with-keychain-support 15 0%
#2,139 asymptote 15 0%
#2,140 ladislavb/therion-studio/therion-studio 15 0%
#2,141 sidaf/pentest/wfuzz 15 0%
#2,142 franzenzenhofer/tap/bigarrow 15 0%
#2,143 vroom 15 0%
#2,144 gitui 15 0%
#2,145 dos2unix 15 0%
#2,146 kabel/pecl/php-xdebug 15 0%
#2,147 cassandra 15 0%
#2,148 mczachurski/wallpapper/wallpapper 15 0%
#2,149 evernote-backup 15 0%
#2,150 hacker1024/hacker1024/coretemp 15 0%
#2,151 dlib 15 0%
#2,152 fahasch/formulae/fricas 15 0%
#2,153 got 15 0%
#2,154 duolahypercho/codex-router/codex-router 15 0%
#2,155 florianbruniaux/tap/ccboard 15 0%
#2,156 enigma --HEAD 15 0%
#2,157 phoneinfoga 15 0%
#2,158 libkrun/krun/libkrun 15 0%
#2,159 kimsgent/indexly/indexly 15 0%
#2,160 allureofthestars 15 0%
#2,161 apache-polaris 15 0%
#2,162 goreleaser 15 0%
#2,163 fontforge --HEAD 15 0%
#2,164 kobie-bendalak/orchlane/orchlane 15 0%
#2,165 filosottile/musl-cross/musl-cross --with-arm-hf --without-aarch64 --without-x86_64 15 0%
#2,166 ziadalzarka/tap/icloud-image-labeler 15 0%
#2,167 yosys --HEAD 15 0%
#2,168 aws-iam-authenticator 15 0%
#2,169 alberthuangt/playit/playit 15 0%
#2,170 excitedplus1s/repo/optool 15 0%
#2,171 icanhasjonas/tap/icloud-tools 15 0%
#2,172 harmonybrew/core/jasper 15 0%
#2,173 wpscanteam/tap/wpscan --HEAD 15 0%
#2,174 far2l-tty 15 0%
#2,175 mold 15 0%
#2,176 tigger04/tap/superscale 15 0%
#2,177 osrf/simulation/ignition-transport8 15 0%
#2,178 harmonybrew/core/redis 15 0%
#2,179 pablosanderman/gamenetworkingsockets/gamenetworkingsockets 15 0%
#2,180 influxdb 15 0%
#2,181 imagemagick-full 15 0%
#2,182 googletest 15 0%
#2,183 balena-cli 15 0%
#2,184 ottomatic-io/video/libmxf 15 0%
#2,185 telegraf 15 0%
#2,186 claude-monitor 15 0%
#2,187 mupdf-tools 15 0%
#2,188 gromgit/fuse/btfs-mac 15 0%
#2,189 dciabrin/ngdevkit/ngdevkit 15 0%
#2,190 vlang 15 0%
#2,191 facebook/fb/fbthrift-compiler 15 0%
#2,192 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-ctags --with-imagemagick --with-native-comp --with-native-full-aot --with-pdumper --with-tree-sitter --with-xwidgets 15 0%
#2,193 bgreenwell/xleak/xleak 15 0%
#2,194 nyabutid/makini/makini 15 0%
#2,195 stlink --HEAD 15 0%
#2,196 jzaleski/jzaleski/apg 15 0%
#2,197 z80oolong/eaw/mutt@9999-dev 15 0%
#2,198 risingwavelabs/risingwave/risingwave 15 0%
#2,199 brewsci/bio/salmon 15 0%
#2,200 zigmod 15 0%
#2,201 btcli 15 0%
#2,202 antonio-lunarg/lunarg/vulkan-sdk 15 0%
#2,203 mpich 15 0%
#2,204 freeapp2014/stuff/openrevolution 15 0%
#2,205 nmdp-bioinformatics/tap/py-ard 15 0%
#2,206 grantcarthew/tap/snag 15 0%
#2,207 gmrandazzo/gmr/rdock --HEAD 15 0%
#2,208 unison 15 0%
#2,209 lawrencecurtis/tap/libvmaf 15 0%
#2,210 coin-or-tools/coinor/clp 15 0%
#2,211 ios-webkit-debug-proxy --HEAD 15 0%
#2,212 keith/formulae/dyld-shared-cache-extractor 15 0%
#2,213 tfcollins/formulae/gr-iio --HEAD 15 0%
#2,214 neko 15 0%
#2,215 franklinchen/tap/hugs --HEAD 15 0%
#2,216 torsocks 15 0%
#2,217 ignite 15 0%
#2,218 jrmastermodelbuilder/swftools/swftools-stable 15 0%
#2,219 railway 14 0%
#2,220 brewsci/num/brewsci-mumps 14 0%
#2,221 tyhal/tap/crie 14 0%
#2,222 pocl 14 0%
#2,223 ocp 14 0%
#2,224 pkg-config 14 0%
#2,225 gnucobol --HEAD 14 0%
#2,226 redis@8.2 14 0%
#2,227 navidrome 14 0%
#2,228 arcade-learning-environment 14 0%
#2,229 datalegion-ai/tap/datalegion-cli 14 0%
#2,230 dubsopenhub/copilot-cli-agent-pulse/agent-pulse 14 0%
#2,231 dxtich/core/qemu@8.0.4 14 0%
#2,232 moreutils 14 0%
#2,233 eksctl 14 0%
#2,234 trzsz 14 0%
#2,235 baidupcs-go 14 0%
#2,236 markitdown 14 0%
#2,237 dstack 14 0%
#2,238 cdktf 14 0%
#2,239 hf-mount 14 0%
#2,240 spoofdpi 14 0%
#2,241 kojix2/brew/sdust 14 0%
#2,242 osgeo/osgeo4mac/osgeo-libkml 14 0%
#2,243 binwalk 14 0%
#2,244 mariadb@11.8 14 0%
#2,245 mle 14 0%
#2,246 qwen-code 14 0%
#2,247 jasonmadigan/tap/podman-mac-net-connect 14 0%
#2,248 corvuszero/openssl-apple-m1_1_0_2/openssl@1.0.2t 14 0%
#2,249 keeper-commander 14 0%
#2,250 mac-cleanup-go 14 0%
#2,251 fastlane --HEAD 14 0%
#2,252 grimme-lab/qc/toml-f 14 0%
#2,253 rust-analyzer 14 0%
#2,254 kkdd/tap/bash32 14 0%
#2,255 matchy256/matchy/ng-utf8 14 0%
#2,256 tsotchke/eshkol/eshkol 14 0%
#2,257 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-blueshark --with-flash --with-smartcard 14 0%
#2,258 redis-developer/core/redisearch 14 0%
#2,259 newsboat 14 0%
#2,260 puleeno/openlitespeed/admin_php 14 0%
#2,261 davrodpin/mole/mole 14 0%
#2,262 prek 14 0%
#2,263 cursusx/cursusx/cursusx 14 0%
#2,264 utox39/tap/zigfetch 14 0%
#2,265 sapsaldog/symphony/symphony 14 0%
#2,266 certbot 14 0%
#2,267 sysbench 14 0%
#2,268 idomizrachi-bringg/dev-tools/sourcery 14 0%
#2,269 trzsz-ssh 14 0%
#2,270 anhoder/go-musicfox/go-musicfox --HEAD 14 0%
#2,271 pothosware/pothos/soapyplutosdr 14 0%
#2,272 michael-simons/seabolt/seabolt 14 0%
#2,273 visp 14 0%
#2,274 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-imagemagick --with-xwidgets 14 0%
#2,275 benesch/os161/os161-gcc 14 0%
#2,276 tinyxml 14 0%
#2,277 gcovr 14 0%
#2,278 sc-im 14 0%
#2,279 putty 14 0%
#2,280 stylish-haskell 14 0%
#2,281 2dubu/tap/macfanctl 14 0%
#2,282 beets 14 0%
#2,283 abuchanan-figment/testformula2/andrewtest 14 0%
#2,284 taylorwilsdon/tap/reclaimed 14 0%
#2,285 tox/tox/libtoxcore 14 0%
#2,286 jholloc/formulae/uda 14 0%
#2,287 luacheck 14 0%
#2,288 denji/nginx/nginx-full --with-brotli-module 14 0%
#2,289 shinji-kono/fuse-ext2/fuse-ext2 14 0%
#2,290 gtk+ 14 0%
#2,291 usage 14 0%
#2,292 zssh 14 0%
#2,293 geolessel/repo/trello-cli 14 0%
#2,294 harmonybrew/core/hdc 14 0%
#2,295 codex-acp 14 0%
#2,296 glib --HEAD 14 0%
#2,297 lua 14 0%
#2,298 prowler 14 0%
#2,299 fracturedjson 14 0%
#2,300 brewsci/science/wfdb 14 0%
#2,301 jfb3615/repo/qat 14 0%
#2,302 ast-grep 14 0%
#2,303 tw93/tap/mole 14 0%
#2,304 bates64/brew/mips-linux-gnu-gcc 14 0%
#2,305 timescale/tap/timescaledb --with-oss-only 14 0%
#2,306 rtmidi 14 0%
#2,307 hlrs-vis/tap/vistle --HEAD 14 0%
#2,308 hunk 14 0%
#2,309 d12frosted/emacs-plus/emacs-plus@31 --with-savchenkovaleriy-big-sur-icon --with-xwidgets 14 0%
#2,310 qcachegrind 14 0%
#2,311 freecad/freecad/freecad@1.0.2_py312 --HEAD 14 0%
#2,312 dbwang0130/clscli/clscli 14 0%
#2,313 tippx 14 0%
#2,314 wgcf 14 0%
#2,315 jrmastermodelbuilder/swftools/swftools-dev 14 0%
#2,316 arthurk/virt-manager/virt-viewer 14 0%
#2,317 codemakerai/tap/codemaker-cli 14 0%
#2,318 yeongung-kim/zathura/zathura --with-synctex 14 0%
#2,319 bannebanning/logician/logician 14 0%
#2,320 davep/homebrew/braindrop 14 0%
#2,321 yohey/common/mozc-emacs-helper 14 0%
#2,322 kallisto 14 0%
#2,323 hpd-ai/tap/hpdos-beta 14 0%
#2,324 brewsci/bio/patinae 14 0%
#2,325 mandoc 14 0%
#2,326 bl4cc4t/vsplugins/vsp-fmtconv 14 0%
#2,327 pgroonga 14 0%
#2,328 robertjakub/teller/googerteller --HEAD 14 0%
#2,329 sfml --HEAD 14 0%
#2,330 elmercsc/elmerfem/elmer --without-hypre --without-mumps --without-open-mpi 14 0%
#2,331 speech --HEAD 14 0%
#2,332 makew0rld/tap/didder 14 0%
#2,333 sqldef/sqldef/psqldef 14 0%
#2,334 ruff 14 0%
#2,335 atompaw/repo/atompaw 14 0%
#2,336 livebook-cli 14 0%
#2,337 sapling 14 0%
#2,338 pkuksa/tap/filer-giggle 14 0%
#2,339 morpheus-lab/morpheus-versions/morpheus@2.3.9 14 0%
#2,340 flutterando/slidy/slidy 14 0%
#2,341 theapplegates/kleopatra6mac/kf6-kio 14 0%
#2,342 root --HEAD 14 0%
#2,343 wuppiefuzz 14 0%
#2,344 ignite-ember/tap/ignite-ember 14 0%
#2,345 hk 14 0%
#2,346 danieljprice/all/splash 14 0%
#2,347 brewsci/bio/gmap-gsnap 14 0%
#2,348 brewsci/bio/raven-assembler 14 0%
#2,349 theapplegates/kleopatra6mac/kleopatra 14 0%
#2,350 libpqxx 14 0%
#2,351 tgtakaoka/msp430-elf/gdb-msp430-elf 14 0%
#2,352 brewsci/science/ds9 14 0%
#2,353 nexus 14 0%
#2,354 rgsystemes/qt4/openssl@1.0 --with-universal 14 0%
#2,355 azure-dev 14 0%
#2,356 btbutts/oxvelte/oxvelte 13 0%
#2,357 tenseleyflow/tap/hyprkvm 13 0%
#2,358 xxxbrian/tap/cserun 13 0%
#2,359 lima-additional-guestagents 13 0%
#2,360 d12frosted/emacs-plus/emacs-plus@31 --with-elrumo1-icon --with-imagemagick --with-mailutils --with-smooth-cursor --with-xwidgets 13 0%
#2,361 pdf2htmlex/brewtap/pdf2htmlex-new 13 0%
#2,362 amrkmn/tap/croc 13 0%
#2,363 osgeo/osgeo4mac/osgeo-hdf4 --without-szip 13 0%
#2,364 dislocker 13 0%
#2,365 ipmitool 13 0%
#2,366 dcshock/provenance/provenanced 13 0%
#2,367 shivammathur/extensions/pecl_http@8.6 13 0%
#2,368 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --without-modules 13 0%
#2,369 ardour 13 0%
#2,370 petere/postgresql/postgresql@14 13 0%
#2,371 ladislavb/therion/therion --HEAD 13 0%
#2,372 cmocka 13 0%
#2,373 autobrr 13 0%
#2,374 helderperez-dev/voodoo/voodoo 13 0%
#2,375 cargo-geiger 13 0%
#2,376 zmarcantel/libsoil/libsoil 13 0%
#2,377 pymupdf 13 0%
#2,378 rmbell09-lang/tradesight/tradesight 13 0%
#2,379 kabel/php-ext/php@8.3-imap 13 0%
#2,380 flow-control --HEAD 13 0%
#2,381 echtvar 13 0%
#2,382 asternic/wuzapi/wuzapi 13 0%
#2,383 libepoxy 13 0%
#2,384 lnav --HEAD 13 0%
#2,385 skaffold 13 0%
#2,386 ashabbir/savant/savant-context 13 0%
#2,387 kubetail 13 0%
#2,388 lmod 13 0%
#2,389 open-babel 13 0%
#2,390 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 13 0%
#2,391 whisperkit-cli 13 0%
#2,392 libgccjit --HEAD 13 0%
#2,393 openfortivpn 13 0%
#2,394 mashb1t/susops/susops 13 0%
#2,395 eddieantonio/eddieantonio/imgcat 13 0%
#2,396 pomerium 13 0%
#2,397 telegram-downloader 13 0%
#2,398 gjbauer/msp430-elf/gcc-msp430-elf 13 0%
#2,399 seaweedfs 13 0%
#2,400 zegervdv/zathura/zathura-pdf-mupdf 13 0%
#2,401 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libzvbi 13 0%
#2,402 twio142/tap/propertree 13 0%
#2,403 luckyframework/lucky/lucky 13 0%
#2,404 podofo 13 0%
#2,405 d12frosted/emacs-plus/emacs-plus@30 --HEAD 13 0%
#2,406 akatmks/vapoursynth-plugins/vapoursynth-lsmas-ffmpeg-6 --HEAD 13 0%
#2,407 camdencheek/brew/fre 13 0%
#2,408 gumbo-parser 13 0%
#2,409 you-get 13 0%
#2,410 typst 13 0%
#2,411 osrf/simulation/ignition-fortress 13 0%
#2,412 projectm --HEAD 13 0%
#2,413 libplist --HEAD 13 0%
#2,414 libyaml 13 0%
#2,415 d2 13 0%
#2,416 harmonybrew/core/cabal-install 13 0%
#2,417 cameroncooper/tap/zbase 13 0%
#2,418 usedhonda/tap/ccsl 13 0%
#2,419 uffizzi 13 0%
#2,420 pothosware/pothos/soapyuhd --HEAD 13 0%
#2,421 rocksdb 13 0%
#2,422 afni/mesa-25.3.4/mesa@25.3.4 13 0%
#2,423 dxpy 13 0%
#2,424 asymptotic-code/sui-prover/sui-prover 13 0%
#2,425 scirooplot/scirooplot/scirooplot 13 0%
#2,426 vfkit 13 0%
#2,427 d12frosted/emacs-plus/emacs-plus@28 --with-native-comp 13 0%
#2,428 rxseger/hackrf/lte-cell-scanner --HEAD 13 0%
#2,429 d12frosted/emacs-plus/emacs-plus@32 --with-dbus --with-mailutils --with-xwidgets 13 0%
#2,430 osgeo/osgeo4mac/osgeo-saga-lts 13 0%
#2,431 bdw-gc 13 0%
#2,432 wxpython 13 0%
#2,433 itstool --HEAD 13 0%
#2,434 elmercsc/elmerfem/elmer --HEAD --without-mumps 13 0%
#2,435 gopass 13 0%
#2,436 gromacs 13 0%
#2,437 libngtcp2 --HEAD 13 0%
#2,438 xberg-io/tap/xberg 13 0%
#2,439 steipete/tap/mcporter 13 0%
#2,440 harmonybrew/core/deepseek-harness 13 0%
#2,441 theapplegates/kleopatra6mac/gpgme 13 0%
#2,442 beast 13 0%
#2,443 aovestdipaperino/tap/tokensave 13 0%
#2,444 certifi 13 0%
#2,445 collada-dom 13 0%
#2,446 kahip/kahip/viecut 13 0%
#2,447 indilib/indi/libcfitsio 13 0%
#2,448 wsjtx 13 0%
#2,449 fstark/macflim/flimmaker 13 0%
#2,450 vulkan-profiles 13 0%
#2,451 libpq@16 13 0%
#2,452 llvm-hs/llvm/llvm-12 13 0%
#2,453 openstackclient 13 0%
#2,454 searlsco/tap/scrapple 13 0%
#2,455 makew0rld/tap/didder --HEAD 13 0%
#2,456 pmolfese/mesa-25.3.4/mesa@25.3.4 13 0%
#2,457 codanna 13 0%
#2,458 kojix2/brew/lolcat 13 0%
#2,459 restream/reindexer/reindexer 13 0%
#2,460 ansible@9 13 0%
#2,461 omnigent-ai/tap/omnigent --HEAD 13 0%
#2,462 wordgrinder --HEAD 13 0%
#2,463 michaelroosz/ssh/libsk-libfido2 13 0%
#2,464 codex --HEAD 13 0%
#2,465 mycli 13 0%
#2,466 haproxy 13 0%
#2,467 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-imagemagick --with-mailutils --with-xwidgets 13 0%
#2,468 botantony/cmake3/cmake3 13 0%
#2,469 ffmpeg@4 13 0%
#2,470 homebrew-zathura/zathura/zathura --with-no-titlebar 13 0%
#2,471 ownia/ownia/so-novel 13 0%
#2,472 milesbuckton/qemu-virgl/virglrenderer 13 0%
#2,473 nejohnson2/sdr/libosmocore --HEAD 13 0%
#2,474 raxml-ng 13 0%
#2,475 fresh-editor 13 0%
#2,476 icp-cli 13 0%
#2,477 cfstras/wol/wol --HEAD 13 0%
#2,478 mc-rtc/mc-rtc/eigen-quadprog 13 0%
#2,479 ghc@9.12 13 0%
#2,480 libao 13 0%
#2,481 vale 13 0%
#2,482 mvtools 13 0%
#2,483 llvm@18 13 0%
#2,484 opengrep 13 0%
#2,485 drogon 13 0%
#2,486 gentleman-programming/tap/gentleman-dots 13 0%
#2,487 kubescape 13 0%
#2,488 ambiit/mpv/mpv --HEAD 13 0%
#2,489 bobtianqiwei/tap/terminal-zen 13 0%
#2,490 rvanbaalen/tap/mdreader 13 0%
#2,491 radiusmethod/awsd/awsd 13 0%
#2,492 justindal/apple-docs-mcp/apple-docs-mcp-server 12 0%
#2,493 bender 12 0%
#2,494 rapid-mlx 12 0%
#2,495 neovim-qt --HEAD 12 0%
#2,496 shivammathur/extensions/newrelic@8.4 12 0%
#2,497 keploy 12 0%
#2,498 lomotho/taps/n2n 12 0%
#2,499 scaccogatto/tap/nastro 12 0%
#2,500 peaceiris/tap/robots 12 0%
#2,501 helmfile 12 0%
#2,502 rockymadden/rockymadden/somafm-cli 12 0%
#2,503 opencrabs 12 0%
#2,504 startergo/gn/gn 12 0%
#2,505 tadelunso/tap/mole-widget 12 0%
#2,506 openconnect 12 0%
#2,507 mhersson/formulas/mpls 12 0%
#2,508 ansible@10 12 0%
#2,509 wasi-libc 12 0%
#2,510 homebrew-ffmpeg/ffmpeg/ffmpeg --with-opencore-amr 12 0%
#2,511 brewsci/science/moab 12 0%
#2,512 get_iplayer 12 0%
#2,513 teicorian/baased/baased 12 0%
#2,514 felin-arch/brew/snx 12 0%
#2,515 openhantek6022 12 0%
#2,516 moduna-ai/qcp/qcp 12 0%
#2,517 ttrftech/adalm-pluto/libiio 12 0%
#2,518 brewsci/bio/coot12 --HEAD 12 0%
#2,519 vulcain 12 0%
#2,520 harbour --HEAD 12 0%
#2,521 d12frosted/emacs-plus/emacs-plus@30 --with-mailutils 12 0%
#2,522 docdyhr/tap/drop2md 12 0%
#2,523 openvdb 12 0%
#2,524 marcus/tap/td 12 0%
#2,525 px4/px4/fastdds 12 0%
#2,526 sijanc147/formulas/macprefs 12 0%
#2,527 gimme-aws-creds 12 0%
#2,528 afl++ 12 0%
#2,529 iceman1001/proxmark3/proxmark3 --HEAD 12 0%
#2,530 open-geocomputing/brew/g2s 12 0%
#2,531 sratoolkit 12 0%
#2,532 brewsci/bio/openms 12 0%
#2,533 alice 12 0%
#2,534 caraya/rivendellweb/weasyprint-rw 12 0%
#2,535 gotun 12 0%
#2,536 ggerganov/ggerganov/hnterm 12 0%
#2,537 screen 12 0%
#2,538 libetpan 12 0%
#2,539 vulkan-headers 12 0%
#2,540 flagrama/tap/n64 --HEAD 12 0%
#2,541 brewsci/bio/biobloomtools 12 0%
#2,542 recmanj-org/ecmwf/eckit 12 0%
#2,543 pothosware/pothos/pothosflow 12 0%
#2,544 libdeflate 12 0%
#2,545 vapoursynth-sub 12 0%
#2,546 falcosecurity-libs 12 0%
#2,547 dosbox-staging 12 0%
#2,548 activemq-cpp 12 0%
#2,549 stripe-cli 12 0%
#2,550 anirudhg07/anirudhg07/cheatshh 12 0%
#2,551 unril/tap/klspw 12 0%
#2,552 osrf/simulation/gz-sensors9 12 0%
#2,553 libseccomp 12 0%
#2,554 swagger-codegen 12 0%
#2,555 nethack --HEAD 12 0%
#2,556 harmonybrew/core/node 12 0%
#2,557 knazarov/qemu-virgl/libepoxy-angle 12 0%
#2,558 mjakeman/gnome/vte 12 0%
#2,559 shivammathur/extensions/firebird-client@3 12 0%
#2,560 datadog-static-analyzer 12 0%
#2,561 libbladerf 12 0%
#2,562 sccache 12 0%
#2,563 vulkan-loader 12 0%
#2,564 gnuplot --HEAD 12 0%
#2,565 i686-elf-grub 12 0%
#2,566 rdb 12 0%
#2,567 tree-sitter-cli --HEAD 12 0%
#2,568 harmonybrew/core/celero 12 0%
#2,569 weechat 12 0%
#2,570 sleef 12 0%
#2,571 pyenv --HEAD 12 0%
#2,572 prrte --HEAD 12 0%
#2,573 gmerlino/yad/yad 12 0%
#2,574 dug 12 0%
#2,575 esbuild 12 0%
#2,576 jakob-bagterp/index-now-for-python/index-now-for-python 12 0%
#2,577 mist-cli 12 0%
#2,578 thrift 12 0%
#2,579 nut 12 0%
#2,580 jira-cli 12 0%
#2,581 ishanawal/tap/termmark 12 0%
#2,582 sapling --HEAD 12 0%
#2,583 vuls 12 0%
#2,584 sethrfore/r-srf/cairo-x11 12 0%
#2,585 lanraragi 12 0%
#2,586 theapplegates/kleopatra6mac/qgpgme-qt6 12 0%
#2,587 rithvik-duddupudi/honeyhex/honeyhex 12 0%
#2,588 flex 12 0%
#2,589 brokenax3/tap/robotframework-robocop 12 0%
#2,590 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-imagemagick 12 0%
#2,591 unbeatable-101/sshwifty/sshwifty 12 0%
#2,592 defanglabs/defang/defang 12 0%
#2,593 icecast 12 0%
#2,594 punt-labs/tap/quarry 12 0%
#2,595 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac 12 0%
#2,596 googleworkspace-cli 12 0%
#2,597 pandoc-plot 12 0%
#2,598 powerman 12 0%
#2,599 theapplegates/kleopatra6mac/kpim6-mimetreeparser 12 0%
#2,600 handbrake --HEAD 12 0%
#2,601 hlrs-vis/tap/covise 12 0%
#2,602 filosottile/musl-cross/musl-cross --with-arm-hf 12 0%
#2,603 lazyjj 12 0%
#2,604 brewsci/bio/foldseek 12 0%
#2,605 cloudsmith-io/cloudsmith-cli/cloudsmith-cli 12 0%
#2,606 lloydzhou/tap/bash-agent 12 0%
#2,607 gbevin/tools/routemidi 12 0%
#2,608 bsc 12 0%
#2,609 signalwire/signalwire/libks 12 0%
#2,610 lighthouse 12 0%
#2,611 elmercsc/elmerfem/elmer --with-elmergui --with-openmp --with-testing 12 0%
#2,612 qalculate-gtk 12 0%
#2,613 nano --HEAD 12 0%
#2,614 pothosware/pothos/soapysdr 12 0%
#2,615 otterdog 12 0%
#2,616 gnustep-base 12 0%
#2,617 argo 12 0%
#2,618 libint 12 0%
#2,619 homebrew-zathura/zathura/zathura --with-no-titlebar --with-synctex 12 0%
#2,620 ponyc 12 0%
#2,621 goctl 12 0%
#2,622 xfangfang/wiliwili/ffmpeg-wiliwili 12 0%
#2,623 arturo 12 0%
#2,624 dimentium/autoraise/autoraise 12 0%
#2,625 stek29/idevice/tsschecker --HEAD 12 0%
#2,626 swift-protobuf 12 0%
#2,627 cups 12 0%
#2,628 polidisio/tap/bigfiles 12 0%
#2,629 libusbmuxd 12 0%
#2,630 notmuch 11 0%
#2,631 glfw 11 0%
#2,632 kanata --HEAD 11 0%
#2,633 onevcat/tap/ca 11 0%
#2,634 argyll-cms 11 0%
#2,635 cosign 11 0%
#2,636 libgphoto2 --HEAD 11 0%
#2,637 xboard 11 0%
#2,638 claude-squad 11 0%
#2,639 curl --HEAD 11 0%
#2,640 mistydemeo/formulae/gbdk --HEAD 11 0%
#2,641 leonid-shutov/tuiwarden/tuiwarden 11 0%
#2,642 ddccontrol 11 0%
#2,643 zbar --HEAD 11 0%
#2,644 snapcast 11 0%
#2,645 grimme-lab/qc/s-dftd3 11 0%
#2,646 morpheus-lab/morpheus-versions/morpheus-release --HEAD 11 0%
#2,647 ldpl 11 0%
#2,648 crystal-ameba/ameba/ameba-ls 11 0%
#2,649 ffmate 11 0%
#2,650 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 11 0%
#2,651 haskell-language-server 11 0%
#2,652 lavinmq 11 0%
#2,653 claws-mail 11 0%
#2,654 shopify/shopify/ejson 11 0%
#2,655 arp-scan-rs 11 0%
#2,656 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-xwidgets 11 0%
#2,657 intona/ethernet-debugger/nose --HEAD 11 0%
#2,658 cfrds 11 0%
#2,659 shivammathur/extensions/newrelic@8.3 11 0%
#2,660 capstone 11 0%
#2,661 rene-dev/sigrok/pulseview 11 0%
#2,662 rizin 11 0%
#2,663 jademind/tap/pi-statusbar 11 0%
#2,664 zabbix 11 0%
#2,665 felinks 11 0%
#2,666 hatari 11 0%
#2,667 lua-language-server 11 0%
#2,668 pv 11 0%
#2,669 framework-tool-tui 11 0%
#2,670 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-generic --with-small 11 0%
#2,671 seayniclabs/tap/sound 11 0%
#2,672 soapysdr 11 0%
#2,673 ncrack --HEAD 11 0%
#2,674 hurl 11 0%
#2,675 createchstudio/cpc/cpc 11 0%
#2,676 wxlua 11 0%
#2,677 speech 11 0%
#2,678 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-modern-icon-elrumo1 --with-mps --with-native-full-aot --with-tree-sitter --with-xwidgets 11 0%
#2,679 harmonybrew/core/ntp 11 0%
#2,680 llvm-hs/llvm/llvm-4.0 11 0%
#2,681 hlrs-vis/tap/osgephemeris 11 0%
#2,682 worktrunk 11 0%
#2,683 davidlee/spec-driver/spec-driver 11 0%
#2,684 naabu 11 0%
#2,685 ccextractor 11 0%
#2,686 valkey 11 0%
#2,687 rtorrent 11 0%
#2,688 valhalla/valhalla/valhalla 11 0%
#2,689 brewsci/base/shiny-server 11 0%
#2,690 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 11 0%
#2,691 mtoc 11 0%
#2,692 akiomik/dev/libuws 11 0%
#2,693 irssi 11 0%
#2,694 dnsdist 11 0%
#2,695 ugrep 11 0%
#2,696 cartesi/tap/cartesi-machine-emulator 11 0%
#2,697 volk 11 0%
#2,698 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-native-comp 11 0%
#2,699 optimizers/cutest/cutest 11 0%
#2,700 fasttrackorg/fasttrack/fasttrack 11 0%
#2,701 uenob/qemu-hvf/qemu-hvf --HEAD 11 0%
#2,702 animdl 11 0%
#2,703 libaegis 11 0%
#2,704 libusb --HEAD 11 0%
#2,705 bstadt/claudeconnect/claudeconnect 11 0%
#2,706 lgarron/lgarron/naughty-list --HEAD 11 0%
#2,707 ajrosen/tap/bitwarden-accelerator 11 0%
#2,708 lief-patchelf 11 0%
#2,709 gromgit/fuse/gcsfuse-mac 11 0%
#2,710 d12frosted/emacs-plus/emacs-plus@28 11 0%
#2,711 d12frosted/emacs-plus/emacs-plus@30 --with-elrumo2-icon 11 0%
#2,712 osrf/simulation/gz-gui9 11 0%
#2,713 freifunkmuc/proxyguard-client/proxyguardclient 11 0%
#2,714 amjaradat01/awesome-lazy-zsh/awesome-lazy-zsh 11 0%
#2,715 proxychains-ng 11 0%
#2,716 anakaiti/tap/gcloud 11 0%
#2,717 px4/px4/fastcdr 11 0%
#2,718 deus0ww/tap/ffmpeg 11 0%
#2,719 kpeeters/repo/cadabra2-devel 11 0%
#2,720 dbt-labs/dbt/dbt 11 0%
#2,721 rapidjson 11 0%
#2,722 forketyfork/tap/clawtunes 11 0%
#2,723 fontforge 11 0%
#2,724 cdo 11 0%
#2,725 opensca-cli 11 0%
#2,726 aubio 11 0%
#2,727 sukkola/tap/jqpp 11 0%
#2,728 pcl 11 0%
#2,729 jar-cart 11 0%
#2,730 gkrellm 11 0%
#2,731 scriptedalchemy/tap/tracedecay 11 0%
#2,732 go@1.24 11 0%
#2,733 octoenergy/tap/kraken-cli-test 11 0%
#2,734 koka 11 0%
#2,735 steipete/tap/eightctl 11 0%
#2,736 kingfisher 11 0%
#2,737 totoshko88/rustconn/rustconn 11 0%
#2,738 lume 11 0%
#2,739 postgresql@11 11 0%
#2,740 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-natural-title-bar --with-xwidgets 11 0%
#2,741 hysteria 11 0%
#2,742 pocket-tts 11 0%
#2,743 softhsm 11 0%
#2,744 cve-bin-tool 11 0%
#2,745 tectonic 11 0%
#2,746 ccache --HEAD 11 0%
#2,747 d12frosted/emacs-plus/emacs-plus@29 --with-modern-doom3-icon --with-native-comp 11 0%
#2,748 cloud-gov/cloudgov/cg-manage-rds 11 0%
#2,749 openmotif 11 0%
#2,750 pcb2gcode --HEAD 11 0%
#2,751 homeassistant-cli 11 0%
#2,752 taf2/tap/mdvi 11 0%
#2,753 aiken 11 0%
#2,754 prometheus 11 0%
#2,755 c0rmac/cbo-stiefel/cbo-stiefel 11 0%
#2,756 osx-cross/avr/avr-gcc@15 11 0%
#2,757 wails 11 0%
#2,758 syslog-ng 11 0%
#2,759 hledger --HEAD 11 0%
#2,760 amlel-el-mahrouss/mips64/mips64-elf-binutils 11 0%
#2,761 esphome 11 0%
#2,762 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-mailutils 11 0%
#2,763 omarshahine/tap/findmy-cli 11 0%
#2,764 convco 11 0%
#2,765 libimagequant 11 0%
#2,766 verlet-robotics/verlet/verlet 11 0%
#2,767 ecl 11 0%
#2,768 breseq 11 0%
#2,769 minify 11 0%
#2,770 haxe --HEAD 11 0%
#2,771 qt5compat 11 0%
#2,772 osrf/simulation/sdformat12 11 0%
#2,773 container --HEAD 11 0%
#2,774 tcc --HEAD 11 0%
#2,775 bowtie2 11 0%
#2,776 vde --HEAD 11 0%
#2,777 kazuakiyama/sched/sched 11 0%
#2,778 shshemi/tabiew/tabiew 11 0%
#2,779 verible 11 0%
#2,780 julian/tap/ardour 11 0%
#2,781 chrihop/gcc_cross_compilers/i686-elf-gdb 11 0%
#2,782 souffle-lang/souffle/souffle --HEAD 11 0%
#2,783 delphinus/sfmono-square/sfmono-square 11 0%
#2,784 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-dbus --with-emacs-big-sur-icon --with-imagemagick --with-mac-metal --with-native-comp 11 0%
#2,785 brewsci/bio/gappa 11 0%
#2,786 libnfs 11 0%
#2,787 francium-tech/tap/scanify 11 0%
#2,788 scouzi1966/afm/mlxlmprobe 11 0%
#2,789 yurijmikhalevich/tap/rclip 11 0%
#2,790 opa 11 0%
#2,791 harmonybrew/core/cpr 10 0%
#2,792 gromgit/fuse/archivemount-mac 10 0%
#2,793 zeek/zeek/spicy 10 0%
#2,794 tknrkb/robocup/rcssserver 10 0%
#2,795 d12frosted/emacs-plus/emacs-plus@30 --with-savchenkovaleriy-big-sur-icon 10 0%
#2,796 opensearch 10 0%
#2,797 mtg/essentia/gaia --HEAD 10 0%
#2,798 rtrlib/pils/rtrlib 10 0%
#2,799 lazygit 10 0%
#2,800 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-librsvg --with-native-compilation --with-starter 10 0%
#2,801 sidaf/pentest/hashid 10 0%
#2,802 knazarov/qemu-virgl/virglrenderer 10 0%
#2,803 keystone 10 0%
#2,804 fi-153/tap/wyoming-apple-speech 10 0%
#2,805 weaviate 10 0%
#2,806 brewsci/science/oce 10 0%
#2,807 d12frosted/emacs-plus/emacs-plus@29 --with-native-comp --with-no-frame-refocus 10 0%
#2,808 pcre 10 0%
#2,809 minizign 10 0%
#2,810 kiota 10 0%
#2,811 marksman 10 0%
#2,812 manticoresearch 10 0%
#2,813 macvim --HEAD 10 0%
#2,814 gxalpha/obs-tools/gersemi_sort 10 0%
#2,815 acl 10 0%
#2,816 iperf3 10 0%
#2,817 chizhovyui/lurii/lurii-pfm 10 0%
#2,818 fastnetmon 10 0%
#2,819 openresty/brew/openresty-debug 10 0%
#2,820 ghcup 10 0%
#2,821 gromgit/brewtils/taproom 10 0%
#2,822 infat 10 0%
#2,823 mmcclatchy/respec-ai/respec-ai 10 0%
#2,824 c-kermit 10 0%
#2,825 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-imagemagick 10 0%
#2,826 zelatrixx/libvips/vips@8.18.0 10 0%
#2,827 arm-none-eabi-binutils 10 0%
#2,828 hunspell 10 0%
#2,829 davidp-icracked/idevicerestore/idevicerestore --HEAD 10 0%
#2,830 sigrok-cli 10 0%
#2,831 rajivshah3/libomp-tap/libomp@11.1.0 10 0%
#2,832 heaths/tap/akv 10 0%
#2,833 stlink 10 0%
#2,834 tuios 10 0%
#2,835 ruby-lsp 10 0%
#2,836 nickthecook/crops/ops 10 0%
#2,837 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-natural-title-bar --with-retro-sink-bw --with-starter 10 0%
#2,838 leoafarias/fvm/fvm@3.2.1 10 0%
#2,839 nedap/versions/gettext@0.20.2 10 0%
#2,840 rrdtool 10 0%
#2,841 plink-ng 10 0%
#2,842 pdal 10 0%
#2,843 emacs --HEAD 10 0%
#2,844 slb350/drep/drep-ai 10 0%
#2,845 redpeacock78/tools/mlterm-cocoa 10 0%
#2,846 mikluko/tap/turbo-fieldfare 10 0%
#2,847 cryptnox/tools/cryptnox-cli 10 0%
#2,848 uchicago-library/attc/attc 10 0%
#2,849 umoci 10 0%
#2,850 fbkarsdorp/lamachine/ticcutils 10 0%
#2,851 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick 10 0%
#2,852 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 10 0%
#2,853 specify 10 0%
#2,854 juanwithjunjie/macirland/macirland 10 0%
#2,855 imkkingshuk/tap/lockknife 10 0%
#2,856 deus0ww/tap/libplacebo 10 0%
#2,857 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-nobu417-big-sur-icon --with-xwidgets 10 0%
#2,858 tychoid/libavif/libyuv 10 0%
#2,859 screenpipe 10 0%
#2,860 thecasualcoder/stable/csvdiff 10 0%
#2,861 acarl005/formulas/ls-go 10 0%
#2,862 omzcj/omzcj/insert_dylib 10 0%
#2,863 nak 10 0%
#2,864 kahip/kahip/heicut 10 0%
#2,865 kanata 10 0%
#2,866 go@1.25 10 0%
#2,867 hirocaster/mozc-emacs-helper/mozc-emacs-helper 10 0%
#2,868 kabel/pecl/php-mailparse 10 0%
#2,869 donn/magic/magic 10 0%
#2,870 wasmedge 10 0%
#2,871 libemf2svg 10 0%
#2,872 codemaster-ar/gpr-hub-beta/gpr-hub-beta 10 0%
#2,873 shellcheck 10 0%
#2,874 petere/postgresql/postgresql@15 10 0%
#2,875 oha 10 0%
#2,876 go@1.22 10 0%
#2,877 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-imagemagick 10 0%
#2,878 nginx/unit/unit 10 0%
#2,879 jkitchin/scimax/scimax 10 0%
#2,880 mfat/sshpilot/sshpilot 10 0%
#2,881 osx-cross/avr/simavr 10 0%
#2,882 brewsci/science/pspp 10 0%
#2,883 replicate/tap/pget 10 0%
#2,884 ualbertaaltlab/hfst/foma --HEAD 10 0%
#2,885 princebharti/tap/leakfix 10 0%
#2,886 felixkratz/formulae/fnnn --HEAD 10 0%
#2,887 swimminghao/local/btop 10 0%
#2,888 open-code-review 10 0%
#2,889 typescript 10 0%
#2,890 mosra/magnum/magnum 10 0%
#2,891 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-imagemagick --with-xwidgets 10 0%
#2,892 sstp-client --HEAD 10 0%
#2,893 cni-plugins 10 0%
#2,894 dwarfs 10 0%
#2,895 gitea-mcp-server 10 0%
#2,896 hayesbarber/tap/srl 10 0%
#2,897 mighttpd2 10 0%
#2,898 tokei 10 0%
#2,899 leedm777/asterisk/asterisk 10 0%
#2,900 rosco-m68k/toolchain/gcc-cross-m68k@11 10 0%
#2,901 petere/postgresql/postgresql@9.3 10 0%
#2,902 breezy 10 0%
#2,903 digital-defiance/tap/bright-iputils 10 0%
#2,904 d12frosted/emacs-plus/emacs-plus@31 --with-mailutils 10 0%
#2,905 mipalgu/tap/swift-modelling 10 0%
#2,906 gundam-organization/tap/gundam 10 0%
#2,907 ulamai/ulamai/ulamai 10 0%
#2,908 lgarron/lgarron/jclone --HEAD 10 0%
#2,909 befovy/taps/fvm 10 0%
#2,910 openpmd/openpmd/openpmd-api 10 0%
#2,911 foma 10 0%
#2,912 fusionlanguage/fut/fut 10 0%
#2,913 jakmro/cactus/cactus 10 0%
#2,914 xenodium/rinku/rinku 10 0%
#2,915 gossip 10 0%
#2,916 astro 10 0%
#2,917 patrik-csak/tap/auto-terminal-profile 10 0%
#2,918 acsandmann/tap/menuanywhere 10 0%
#2,919 theora --HEAD 10 0%
#2,920 olie-ver/testpp/testpp 10 0%
#2,921 daviderestivo/emacs-head/emacs-head@32 --with-cocoa 10 0%
#2,922 guiguem/tap/wcsim 10 0%
#2,923 infer 10 0%
#2,924 mongodb-atlas-cli 10 0%
#2,925 cpptoml 10 0%
#2,926 lensfun --HEAD 10 0%
#2,927 fzf --HEAD 10 0%
#2,928 rakhimov/scram/scram 10 0%
#2,929 movableink/formulas/cassandra 10 0%
#2,930 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libaribb24 --with-libbluray --with-libgsm --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-webp --with-whisper-cpp 10 0%
#2,931 tea 10 0%
#2,932 azcopy 10 0%
#2,933 pdftoipe 10 0%
#2,934 realagiorganization/tap/agent-sessions-rc 10 0%
#2,935 who23/formulae/nchook 10 0%
#2,936 osrf/simulation/ogre1.9 10 0%
#2,937 dovi_tool 10 0%
#2,938 infrahouse/infrahouse-toolkit/infrahouse-toolkit 10 0%
#2,939 cloudflare-quiche 10 0%
#2,940 git-xet 10 0%
#2,941 mumps-parallel 10 0%
#2,942 bl4cc4t/vsplugins/vsp-eedi3 --HEAD 10 0%
#2,943 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-xwidgets 10 0%
#2,944 scaryrawr/formulae/omlx --HEAD --with-audio --with-custom-kernel --with-grammar 10 0%
#2,945 austinjones/taps/tab 10 0%
#2,946 ruby --HEAD 10 0%
#2,947 slint-compiler 10 0%
#2,948 libffi 10 0%
#2,949 lastpass-cli 10 0%
#2,950 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-srt 10 0%
#2,951 hcxtools --HEAD 10 0%
#2,952 innoextract 10 0%
#2,953 deepgram/tap/deepgram 10 0%
#2,954 openlist 10 0%
#2,955 nativeos/i386-elf-toolchain/i386-elf-gdb 10 0%
#2,956 cortexapps/tap/cortexapps-cli 10 0%
#2,957 shimmy 10 0%
#2,958 pachi --HEAD 10 0%
#2,959 shivammathur/extensions/swoole@7.1 10 0%
#2,960 nimahejazi/tap/nh-ask-cli 10 0%
#2,961 limine 10 0%
#2,962 wendylabsinc/tap/wendy 10 0%
#2,963 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-imagemagick --with-xwidgets 10 0%
#2,964 alexei-led/tap/ccbot 10 0%
#2,965 trash-cli 10 0%
#2,966 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal 10 0%
#2,967 opencv --HEAD 10 0%
#2,968 cliutils/apple/libomp 10 0%
#2,969 noobaa/noobaa/noobaa-core 10 0%
#2,970 jeffsteinbok/remarkablesync/remarkablesync 10 0%
#2,971 bareos-client 10 0%
#2,972 wilkart/gridcoin/gridcoin-cli 10 0%
#2,973 inngest/tap/inngest 10 0%
#2,974 tmuxp 10 0%
#2,975 guoqiao/tap/mlx-audio-server 10 0%
#2,976 pypy3.10 10 0%
#2,977 kubescape/tap/kubescape-cli 10 0%
#2,978 d12frosted/emacs-plus/emacs-plus@30 --with-modern-papirus-icon 10 0%
#2,979 mtg/essentia/gaia 10 0%
#2,980 naveenshaji/autopsy/autopsy-memory 10 0%
#2,981 exiv2 10 0%
#2,982 skagedal/formulae/xcode-simulator-cert 10 0%
#2,983 macaulay2/tap/gfan 9 0%
#2,984 cava 9 0%
#2,985 openimageio 9 0%
#2,986 ghostty-terminal 9 0%
#2,987 bsnkhua/tap/mole-widget 9 0%
#2,988 peanut996/tap/cloudflarewarpspeedtest 9 0%
#2,989 harmonybrew/core/portable-git 9 0%
#2,990 ccls 9 0%
#2,991 tehzz/n64-dev/qemu-irix 9 0%
#2,992 sfml@2 9 0%
#2,993 basriram/ceph-client/ceph-client 9 0%
#2,994 circleci 9 0%
#2,995 data-wise/tap/himalaya-mcp 9 0%
#2,996 netdata 9 0%
#2,997 peachlifeab/tap/lgtvctrl 9 0%
#2,998 puleeno/openlitespeed/lsphp73 9 0%
#2,999 tsduck 9 0%
#3,000 rockcarver/frodo-cli/frodo-cli 9 0%
#3,001 sqitchers/sqitch/sqitch --with-mysql-support --with-postgres-support 9 0%
#3,002 brendan-appstart/tap/bead-me-up-scotty 9 0%
#3,003 cog 9 0%
#3,004 testdisk 9 0%
#3,005 dotnet --HEAD 9 0%
#3,006 openargon 9 0%
#3,007 kcov 9 0%
#3,008 cpio 9 0%
#3,009 synodic-studio/synodic/swiftskim --HEAD 9 0%
#3,010 i2pd 9 0%
#3,011 minidlna 9 0%
#3,012 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-zeromq --with-zimg 9 0%
#3,013 epicsbase 9 0%
#3,014 zsv 9 0%
#3,015 ihugang/ocrtool/ocrtool-mcp 9 0%
#3,016 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-librsvg --with-mac-metal --with-native-compilation --with-starter 9 0%
#3,017 marzukia/tap/charted 9 0%
#3,018 cmus 9 0%
#3,019 alfg/tap/bifextract 9 0%
#3,020 check-jsonschema 9 0%
#3,021 crytic-compile 9 0%
#3,022 bjarneo/cliamp/cliamp --HEAD 9 0%
#3,023 getkagaz/kagaz/kagaz-mlx 9 0%
#3,024 glog 9 0%
#3,025 nikgrbn/tap/finder-menu 9 0%
#3,026 concord 9 0%
#3,027 openhemory/hemory/hemory-server-selfhost 9 0%
#3,028 miller 9 0%
#3,029 archetypeai/catalyst/catalyst-edge 9 0%
#3,030 elm-format 9 0%
#3,031 stashapp --HEAD 9 0%
#3,032 zlib 9 0%
#3,033 ghc@9.10 9 0%
#3,034 archi-steam-farm 9 0%
#3,035 expert 9 0%
#3,036 osrf/simulation/gz-rendering9 9 0%
#3,037 aisk/tap/timeout 9 0%
#3,038 wxwidgets --HEAD 9 0%
#3,039 aoe 9 0%
#3,040 jimon-s/pipeline-lens/pipeline-lens 9 0%
#3,041 pgpool-ii 9 0%
#3,042 dan-hart/tap/fgm 9 0%
#3,043 shyamalschandra/screenshot2speech/screenshot2speech 9 0%
#3,044 beordle/tap/termtunnel 9 0%
#3,045 glm 9 0%
#3,046 cvs 9 0%
#3,047 flatironinstitute/ccm/mwrap 9 0%
#3,048 kafkactl 9 0%
#3,049 bgauryy/octocode/octocode 9 0%
#3,050 pothosware/pothos/pothospython 9 0%
#3,051 ffmpeg@5 9 0%
#3,052 llvm@17 9 0%
#3,053 vapoursynth-descale 9 0%
#3,054 fil-technology/tap/ashex 9 0%
#3,055 iqtoolkit/iqtoolkit/iqtoolkit-analyzer 9 0%
#3,056 alberttwong/thrift/thrift@0.13 9 0%
#3,057 jimihford/hendrix/unnks 9 0%
#3,058 grype 9 0%
#3,059 qtshadertools 9 0%
#3,060 hcgatewood/tap/dotsync 9 0%
#3,061 incidentist/nyxt/webkitgtk 9 0%
#3,062 atomicparsley --HEAD 9 0%
#3,063 lcov 9 0%
#3,064 glyph 9 0%
#3,065 harmonybrew/core/hermes-agent 9 0%
#3,066 alps-asd/asd/asd 9 0%
#3,067 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-imagemagick --with-mailutils --with-xwidgets 9 0%
#3,068 maxima 9 0%
#3,069 brewsci/science/pulseview 9 0%
#3,070 graphite2 9 0%
#3,071 tajchert/tap/tink-agent 9 0%
#3,072 snowflake-cli 9 0%
#3,073 rafi/tap/warpd 9 0%
#3,074 jhladik/formulas/nextpnr 9 0%
#3,075 enter-tex 9 0%
#3,076 puleeno/openlitespeed/udns 9 0%
#3,077 grafana/grafana/grafana 9 0%
#3,078 ashabbir/savant-context/savant-context 9 0%
#3,079 liquidsoap 9 0%
#3,080 pothosware/pothos/soapyosmo 9 0%
#3,081 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 9 0%
#3,082 spyicydev/formulae/macblock 9 0%
#3,083 ozeias/postgresql/postgresql@16 9 0%
#3,084 dcraw 9 0%
#3,085 v2raya/v2raya/v2raya-git 9 0%
#3,086 kaito-tokyo/kaito-tokyo/open-webui 9 0%
#3,087 codejoule/tap/mlx-prism 9 0%
#3,088 siril --HEAD 9 0%
#3,089 checkov 9 0%
#3,090 unuran 9 0%
#3,091 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-modern-icon-bokehlicia-captiva --with-native-comp --with-native-full-aot --with-tree-sitter 9 0%
#3,092 zsign 9 0%
#3,093 cbenhagen/video/libmxf 9 0%
#3,094 dissent 9 0%
#3,095 hpack 9 0%
#3,096 ethereum/ethereum/solidity@7 9 0%
#3,097 zadark 9 0%
#3,098 brewsci/bio/clipper4coot 9 0%
#3,099 tern 9 0%
#3,100 elmercsc/elmerfem/elmer --with-elmergui --with-gcc --with-hypre --with-openmp --without-mumps --without-open-mpi 9 0%
#3,101 parsedmarc 9 0%
#3,102 igoropaniuk/tap/stonks-cli 9 0%
#3,103 anvai-labs/tap/victor 9 0%
#3,104 libbladerf --HEAD 9 0%
#3,105 homebrew-ffmpeg/ffmpeg/ffmpeg --with-rubberband 9 0%
#3,106 cxwx/cxbrew/zathura 9 0%
#3,107 d12frosted/emacs-plus/emacs-plus@30 --with-x11 9 0%
#3,108 bl4cc4t/vsplugins/vsp-mvtools 9 0%
#3,109 ns-3 9 0%
#3,110 justadityaraj/tap/foldout 9 0%
#3,111 yunkya2/tap/elf2x68k 9 0%
#3,112 frankieew/tap/lmfdb-cli 9 0%
#3,113 postgres-language-server 9 0%
#3,114 hackrf 9 0%
#3,115 aliyunpan 9 0%
#3,116 virtualenv 9 0%
#3,117 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-vvenc 9 0%
#3,118 myzhang1029/myzhang1029/scopy --HEAD 9 0%
#3,119 rodionovd/taps/shortcuts 9 0%
#3,120 beads --HEAD 9 0%
#3,121 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 9 0%
#3,122 shivammathur/extensions/amqp@8.6 9 0%
#3,123 harmonybrew/core/azure-storage-blobs-cpp 9 0%
#3,124 dillo --HEAD 9 0%
#3,125 libsigrok 9 0%
#3,126 rakudo-star 9 0%
#3,127 brewsci/bio/treepl 9 0%
#3,128 termusic 9 0%
#3,129 brewsci/science/sumo 9 0%
#3,130 terraformer --HEAD 9 0%
#3,131 planck 9 0%
#3,132 diagstudio/tools/diagstudio 9 0%
#3,133 grimley517/tap/notetaker 9 0%
#3,134 myseri/xeneon-edge/xeneon-touch 9 0%
#3,135 tecolicom/tap/app-ansi-tools 9 0%
#3,136 okta-aws-cli 9 0%
#3,137 silvertree2010/apolloshell/apolloshell 9 0%
#3,138 eengl/nceplibs/nceplibs-g2 9 0%
#3,139 britive/pybritive/pybritive 9 0%
#3,140 bnfc 9 0%
#3,141 libpkgmanifest 9 0%
#3,142 build2 9 0%
#3,143 ashmitrrr/berry/berry 9 0%
#3,144 nginx/unit/unit-php 9 0%
#3,145 glab --HEAD 9 0%
#3,146 ivoronin/ivoronin/helix-steel --HEAD 9 0%
#3,147 dkblinux98/nyxgpt/nyxgpt-api@3.0.0rc 9 0%
#3,148 bl4cc4t/vsplugins/vsp-dfttest --HEAD 9 0%
#3,149 shibboleth-sp 9 0%
#3,150 bkmr 9 0%
#3,151 ppsspp 9 0%
#3,152 organize-tool 9 0%
#3,153 spidermonkey 9 0%
#3,154 miniaudio 9 0%
#3,155 tsonglew/dutis/dutis 9 0%
#3,156 grayish/ceph-client/ceph-client 9 0%
#3,157 blitzstudios/brews/itermocil 9 0%
#3,158 yamcha 9 0%
#3,159 max2github/msh/wine 9 0%
#3,160 atac 9 0%
#3,161 chernistry/tap/bernstein 9 0%
#3,162 btdu 9 0%
#3,163 zhangtingan/hermes/hermes-agent 9 0%
#3,164 daviderestivo/fortune-mod/docmake 9 0%
#3,165 willswire/tap/aws_signing_helper 9 0%
#3,166 bayandin/tap/neon-extension 9 0%
#3,167 hirakida/tap/cmake@3.27.1 9 0%
#3,168 xunyss/tap/jdk-manager 9 0%
#3,169 pandocomatic 9 0%
#3,170 miftahganzz/tiksave-cli/tiksave 9 0%
#3,171 libclc 9 0%
#3,172 tditlu/amiga/amiga-gcc 9 0%
#3,173 citus 9 0%
#3,174 qt 9 0%
#3,175 blacktop/tap/frida-node 9 0%
#3,176 gam 9 0%
#3,177 thekevjames/youtube-viewer/youtube-viewer 9 0%
#3,178 libopusenc 9 0%
#3,179 terminal-notifier --HEAD 9 0%
#3,180 denji/nginx/nginx-full 9 0%
#3,181 chef/okta_aws/okta_aws 9 0%
#3,182 kylebrowning/tap/ble 9 0%
#3,183 rockorager/tap/prise --HEAD 9 0%
#3,184 spicetify-cli 9 0%
#3,185 backgroundremover 9 0%
#3,186 shaunplee/rhyme/rhyme 9 0%
#3,187 csound --HEAD 9 0%
#3,188 k-wrk/tap/php-sec 9 0%
#3,189 twinboi90/zoomrecovery/zoomrecovery 9 0%
#3,190 gawk --HEAD 9 0%
#3,191 karinushka/paneru/paneru 9 0%
#3,192 dar 9 0%
#3,193 abcang/azpainter/azpainter 9 0%
#3,194 openrtm/openrtm2/openrtm2-python-py313 9 0%
#3,195 mistral-vibe 9 0%
#3,196 squid 9 0%
#3,197 z3 --HEAD 9 0%
#3,198 pymol 9 0%
#3,199 gl2ps 9 0%
#3,200 sri-csl/sri-csl/yices2 9 0%
#3,201 homebrew-ffmpeg/ffmpeg/ffmpeg --with-librsvg 9 0%
#3,202 botbotbot133/synthetic/synthetic-menubar 9 0%
#3,203 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libaribb24 --with-libaribcaption 9 0%
#3,204 schemathesis 9 0%
#3,205 pr0d1r2/python2/python@2.7.17 9 0%
#3,206 libpathrs 9 0%
#3,207 1rsh/mac-beat-sync/mac-beat-sync 9 0%
#3,208 vpnkit 9 0%
#3,209 librist 9 0%
#3,210 doxygen --HEAD 9 0%
#3,211 d12frosted/emacs-plus/emacs-plus@29 --with-native-comp --with-xwidgets 9 0%
#3,212 theapplegates/kleopatra6mac/kf6-kconfigwidgets 9 0%
#3,213 rfidresearchgroup/proxmark3/proxmark3 --with-flash --with-generic 9 0%
#3,214 senapati484/flowa/flowa 9 0%
#3,215 dynomite 8 0%
#3,216 dimentium/autoraise/autoraise --with-dalternative_task_switcher 8 0%
#3,217 nativeos/i386-elf-toolchain/i386-elf-binutils@2.36.1 8 0%
#3,218 cirruslabs/cli/sshpass 8 0%
#3,219 krets/huemidity/huemidity 8 0%
#3,220 awscrt 8 0%
#3,221 neardws/tap/uni-diff 8 0%
#3,222 mmctl 8 0%
#3,223 ashu-tosh-kumar/command-storage/command-storage 8 0%
#3,224 julia --HEAD 8 0%
#3,225 aqtinstall 8 0%
#3,226 sofusa/tap/rssbook --HEAD 8 0%
#3,227 src 8 0%
#3,228 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-native-comp --with-xwidgets 8 0%
#3,229 sidaf/pentest/nfsshell 8 0%
#3,230 eyhn/tap/kwwk 8 0%
#3,231 ocaml-augeas 8 0%
#3,232 langgraph-cli 8 0%
#3,233 stern 8 0%
#3,234 apib 8 0%
#3,235 brewforge/more/easytier 8 0%
#3,236 picocom 8 0%
#3,237 vineyard 8 0%
#3,238 fuego 8 0%
#3,239 d235j/ios-restore-tools/idevicerestore --HEAD 8 0%
#3,240 ortp 8 0%
#3,241 fedexist/grafatui/grafatui 8 0%
#3,242 pdfly 8 0%
#3,243 twam/openfpga/nextpnr 8 0%
#3,244 kimtholstorf/csvtrim/csvtrim 8 0%
#3,245 cfergeau/crc/vfkit 8 0%
#3,246 philj56/gbcc/gbcc --HEAD 8 0%
#3,247 brewsci/bio/bcalm 8 0%
#3,248 swag 8 0%
#3,249 patat 8 0%
#3,250 brewsci/bio/raster3d 8 0%
#3,251 mikevanl/tap/audiomix 8 0%
#3,252 npnicholson/tools/jlc 8 0%
#3,253 asccli 8 0%
#3,254 leoafarias/fvm/fvm@4.0.0 8 0%
#3,255 nyabutid/entigram/etg 8 0%
#3,256 skip 8 0%
#3,257 ingmarstein/paperless-ngx/paperless-ngx 8 0%
#3,258 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-xwidgets 8 0%
#3,259 octave-app/octave-app/buildbot 8 0%
#3,260 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-libbluray --with-libsoxr --with-two-lame --with-xvid 8 0%
#3,261 moonbase59/tap/ices0 8 0%
#3,262 jinja2-cli 8 0%
#3,263 libnetworkit 8 0%
#3,264 vlc-qt 8 0%
#3,265 mjmorales/tap/keel 8 0%
#3,266 jandedobbeleer/aliae/aliae 8 0%
#3,267 taylorarndt/tap/perspective-cuts 8 0%
#3,268 vdanen/pymnifocus/pymnifocus 8 0%
#3,269 liquidctl --HEAD 8 0%
#3,270 harmonybrew/core/ghc 8 0%
#3,271 intercal 8 0%
#3,272 perryts/perry/perry 8 0%
#3,273 rcmdnk/rcmdnkpac/gmail_filter_manager 8 0%
#3,274 harmonybrew/core/go 8 0%
#3,275 bogdan-calapod/tap/ncytm 8 0%
#3,276 monika 8 0%
#3,277 gascity 8 0%
#3,278 ormolu 8 0%
#3,279 brewsci/bio/gzstream 8 0%
#3,280 jdimatteo/science/samtools@0.1 8 0%
#3,281 superfile 8 0%
#3,282 futhark 8 0%
#3,283 bl4cc4t/vsplugins/vsp-nnedi3 8 0%
#3,284 bl4cc4t/vsplugins/vsp-nnedi3cl 8 0%
#3,285 elmercsc/elmerfem/elmer --with-elmergui --with-openmp --with-testing --without-hypre --without-mumps 8 0%
#3,286 svt/avtools/ffmpeg-encore 8 0%
#3,287 watsonbox/cmu-sphinx/cmu-sphinxbase --HEAD 8 0%
#3,288 zsh --HEAD 8 0%
#3,289 ccsepbvr/pbvr/pbvr 8 0%
#3,290 ryanfb/misc/e57tools 8 0%
#3,291 kushvinth/tap/lic 8 0%
#3,292 minitap-ai/tap/minitest-cli 8 0%
#3,293 lgarron/lgarron/thirdparty-microcad 8 0%
#3,294 horar/openconnect-gui/openconnect-gui 8 0%
#3,295 kapp 8 0%
#3,296 rna-star 8 0%
#3,297 pinocchio 8 0%
#3,298 polkit 8 0%
#3,299 vegeta 8 0%
#3,300 qxmpp 8 0%
#3,301 garnajee/perso/shaka-packager 8 0%
#3,302 cwi-dis/cwipc/cwipc 8 0%
#3,303 pw4ever/zathura/zathura 8 0%
#3,304 tlrc 8 0%
#3,305 video-compare 8 0%
#3,306 apt-dater 8 0%
#3,307 kushvinth/lic/lic 8 0%
#3,308 tamarin-prover/tap/libbuddy 8 0%
#3,309 alebcay/formula/libkrunfw 8 0%
#3,310 dholm/sdr/rtl-sdr --HEAD 8 0%
#3,311 clangen/projectm_musikcube/projectm_musikcube 8 0%
#3,312 f3d 8 0%
#3,313 datadog/pack/pup 8 0%
#3,314 railwaycat/emacsmacport/emacs-mac@29 --with-natural-title-bar 8 0%
#3,315 pothosware/pothos/soapyremote 8 0%
#3,316 carlosqsilva/brew/vfetch 8 0%
#3,317 leveldb 8 0%
#3,318 gnu-apl 8 0%
#3,319 flexiblas 8 0%
#3,320 cooklang/tap/cookcli 8 0%
#3,321 kubeone 8 0%
#3,322 protoc-gen-go-grpc 8 0%
#3,323 shivammathur/extensions/swoole@8.5 8 0%
#3,324 bazel@7 8 0%
#3,325 jvanvinkenroye/pdf-annotator/pdf-annotator 8 0%
#3,326 nanobot 8 0%
#3,327 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-modern-vscode-icon --with-xwidgets 8 0%
#3,328 hlrs-vis/tap/vsgxchange 8 0%
#3,329 lispkit 8 0%
#3,330 fusesoc 8 0%
#3,331 notunrandom/cardano/ogmios 8 0%
#3,332 oama 8 0%
#3,333 encfs --HEAD 8 0%
#3,334 ahsanfazal/tap/voiceink-source 8 0%
#3,335 esbmc 8 0%
#3,336 d12frosted/emacs-plus/emacs-plus@29 --with-modern-papirus-icon --with-native-comp 8 0%
#3,337 complexlogic/tap/rsgain 8 0%
#3,338 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libflite 8 0%
#3,339 tudelft3d/software/city4cfd 8 0%
#3,340 xmedcon 8 0%
#3,341 samikh-git/tools/localrag 8 0%
#3,342 tecolicom/tap/app-greple 8 0%
#3,343 synthemesc/ax/ax 8 0%
#3,344 gh --HEAD 8 0%
#3,345 pts/utils/sam2p 8 0%
#3,346 digzyme/third-party-tools/paml 8 0%
#3,347 aleksrutins/tap/phlexite 8 0%
#3,348 qtserialport 8 0%
#3,349 harmonybrew/core/jid 8 0%
#3,350 python-setuptools 8 0%
#3,351 hivex 8 0%
#3,352 gallantcrusader/bmaptool/bmaptool 8 0%
#3,353 lrzsz 8 0%
#3,354 stuffbucket/qemu-spice/qemu-spice 8 0%
#3,355 notunrandom/cardano/libsodium-cardano 8 0%
#3,356 actonlang/acton/acton 8 0%
#3,357 syncdk/yawsso/yawsso 8 0%
#3,358 mackup --HEAD 8 0%
#3,359 vala 8 0%
#3,360 ezedepetris/moti/moti 8 0%
#3,361 tox 8 0%
#3,362 ssflight/pixdeck/pixdeck 8 0%
#3,363 libconfig 8 0%
#3,364 harmonybrew/core/nim 8 0%
#3,365 hydra --HEAD 8 0%
#3,366 mu --HEAD 8 0%
#3,367 tgtakaoka/mspgcc/gdb-msp430 8 0%
#3,368 adreddy1985/tap/dng-caption 8 0%
#3,369 veracode/tap/gen-ir@0.4.3 8 0%
#3,370 ngrep 8 0%
#3,371 ghostlyrics/sweb/sweb-binutils 8 0%
#3,372 cargo-nextest 8 0%
#3,373 wangle 8 0%
#3,374 riodelphino/tap/macime 8 0%
#3,375 metals 8 0%
#3,376 mpult/mpult/rexit 8 0%
#3,377 gtk-gnutella 8 0%
#3,378 bubblewrap 8 0%
#3,379 jayanaxhf/taps/gitv 8 0%
#3,380 dustinwilson/tap/dbt 8 0%
#3,381 azure-storage-blobs-cpp 8 0%
#3,382 tudelft3d/software/pprepair 8 0%
#3,383 kaito-tokyo/kaito-tokyo/kaito-tokyo-numpy@2.4.4 8 0%
#3,384 groff 8 0%
#3,385 leela-zero 8 0%
#3,386 imessage-exporter 8 0%
#3,387 mwatelescope/tap/casacore 8 0%
#3,388 arustydev/tap/exosphere 8 0%
#3,389 wdm0006/tap/stargazers 8 0%
#3,390 stek29/idevice/libimobiledevice --HEAD 8 0%
#3,391 cwi-dis/cwipc/cwipc --HEAD 8 0%
#3,392 knu/knu/macwin 8 0%
#3,393 chojs23/tap/ec 8 0%
#3,394 mad 8 0%
#3,395 wix/brew/applesimutils --HEAD 8 0%
#3,396 pmolfese/mesa-25.3.4/mesa@25.3 8 0%
#3,397 chef-boneyard/okta_aws/okta_aws 8 0%
#3,398 tueda/loops/kira 8 0%
#3,399 kubebuilder 8 0%
#3,400 gascity --HEAD 8 0%
#3,401 shivammathur/php/php@5.6-debug 8 0%
#3,402 travis-burmaster/ollama-facade/ollama-facade 8 0%
#3,403 xcodegen --HEAD 8 0%
#3,404 python@3.15 --HEAD 8 0%
#3,405 gspell 8 0%
#3,406 c2rust 8 0%
#3,407 c3c --HEAD 8 0%
#3,408 sigreyo/claude-usage/claude-usage 8 0%
#3,409 harmonybrew/core/openssl@3 8 0%
#3,410 tagsistant --HEAD 8 0%
#3,411 gopeed 8 0%
#3,412 casacore/tap/casacore --HEAD 8 0%
#3,413 picoruby 8 0%
#3,414 brewsci/bio/apbs 8 0%
#3,415 skozar/tap/keepalive-cli 8 0%
#3,416 daviderestivo/emacs-head/emacs-head@31 --with-cocoa 8 0%
#3,417 twittemb/formulae/xcodecoverageconverter 8 0%
#3,418 toni7891/deployguard/deployguard 8 0%
#3,419 ryo-ma/lazyhub/lazyhub 8 0%
#3,420 acsandmann/tap/rift --HEAD 8 0%
#3,421 kahip/kahip/oms 8 0%
#3,422 direvent 8 0%
#3,423 dnsx 8 0%
#3,424 poco 8 0%
#3,425 tgray/tgbrew/contacts2 8 0%
#3,426 mdk 8 0%
#3,427 mydumper 8 0%
#3,428 facebook/fb/meta-ads 8 0%
#3,429 graphicsmagick 8 0%
#3,430 goose 8 0%
#3,431 swiftdraw 8 0%
#3,432 catatsuy/tap/curl-http3-libressl 8 0%
#3,433 vfthme/lim/noorfetch 8 0%
#3,434 mbelib --HEAD 8 0%
#3,435 gitsign 8 0%
#3,436 apptainer 8 0%
#3,437 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-mac-metal --with-native-compilation --with-natural-title-bar --with-starter --with-xwidgets 8 0%
#3,438 andyfraussen/tap/vrtnws 8 0%
#3,439 aliscut 8 0%
#3,440 percona-xtrabackup 8 0%
#3,441 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-debug --with-imagemagick --with-mailutils --with-xwidgets 8 0%
#3,442 c0rmac/isomorphism/isomorphism --with-mlx 8 0%
#3,443 oci-cli 8 0%
#3,444 govman-dev/govman/govman 8 0%
#3,445 lnav 8 0%
#3,446 ttrftech/librevna/librevna 8 0%
#3,447 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 8 0%
#3,448 figlet 8 0%
#3,449 dafny 8 0%
#3,450 git-delta --HEAD 8 0%
#3,451 mahirabbas/lemon-graph/lemon-graph 8 0%
#3,452 pmix 8 0%
#3,453 jonatan-verstraete/mopidy/mopidy 8 0%
#3,454 kroki 8 0%
#3,455 cssr-tools/opm/dune-common 8 0%
#3,456 leoafarias/fvm/fvm@2.4.1 8 0%
#3,457 plasma-umass/scalene/scalene --HEAD 8 0%
#3,458 tychoid/libavif/libavif 8 0%
#3,459 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-mailutils 8 0%
#3,460 harmonybrew/core/jpeg-xl 8 0%
#3,461 berkeley-db 8 0%
#3,462 elmercsc/elmerfem/elmer --with-elmergui --with-openmp --without-hypre --without-mumps 8 0%
#3,463 libpcap 8 0%
#3,464 loopwerk/tap/saga 8 0%
#3,465 crystal 8 0%
#3,466 jimmymasaru/repo/fp-gen 8 0%
#3,467 fmuro/amc/auto-multiple-choice 8 0%
#3,468 antoninsiska/tap/file-sorter 8 0%
#3,469 shivammathur/extensions/newrelic@8.0 8 0%
#3,470 jaaasonsun/emacs-plus/emacs-plus@31 --with-savchenkovaleriy-big-sur-icon --with-xwidgets 8 0%
#3,471 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-unlimited-select 8 0%
#3,472 clasp-developers/clasp/clasp-cl 8 0%
#3,473 bzt 8 0%
#3,474 meta-package-manager 8 0%
#3,475 p11-kit --HEAD 8 0%
#3,476 krishcdbry/nexadb/nexadb 8 0%
#3,477 vincentarelbundock/tap/calepin 8 0%
#3,478 bioperl 8 0%
#3,479 duo_unix 8 0%
#3,480 steampipe 8 0%
#3,481 rose-pine/tap/bloom --HEAD 8 0%
#3,482 adelie-ai/adelie/adele-gtk 8 0%
#3,483 prs 8 0%
#3,484 ydah/zing/zing 8 0%
#3,485 opus-tools 8 0%
#3,486 gjs 8 0%
#3,487 djvulibre 8 0%
#3,488 tiennesdm/vedadb/vedadb-server 8 0%
#3,489 nvtop 8 0%
#3,490 nebula 8 0%
#3,491 vzlogger --HEAD 8 0%
#3,492 delph-in/delphin/repp 8 0%
#3,493 cabal-install --HEAD 8 0%
#3,494 doctl 8 0%
#3,495 tholu/tap/subversion18 --with-unicode-path 7 0%
#3,496 ffe 7 0%
#3,497 zackriya-solutions/meetily/meetily-backend 7 0%
#3,498 pow-software/bytesync/bytesync 7 0%
#3,499 atuin-server 7 0%
#3,500 gromgit/fuse/s3fs-mac --HEAD 7 0%
#3,501 zhubert/tap/zwm 7 0%
#3,502 flyznex/taproom/univim --HEAD 7 0%
#3,503 lanraragi --HEAD 7 0%
#3,504 thinkiny/emacs-plus/emacs-plus@31 --with-savchenkovaleriy-big-sur-icon --with-xwidgets 7 0%
#3,505 intake-health/tap/inflow-cli 7 0%
#3,506 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-imagemagick --with-xwidgets 7 0%
#3,507 harmonybrew/core/python@3.14 7 0%
#3,508 bigsy/tap/bigsy-lolgato 7 0%
#3,509 signalwire/signalwire/libyuv 7 0%
#3,510 rhoeplatform/rhoe/rhoe-liquid 7 0%
#3,511 helm@3 7 0%
#3,512 ifuse 7 0%
#3,513 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-xwidgets 7 0%
#3,514 shivammathur/php/php@5.6-debug-zts 7 0%
#3,515 reuse 7 0%
#3,516 gzip 7 0%
#3,517 aws-c-auth 7 0%
#3,518 nasm --HEAD 7 0%
#3,519 libtrace 7 0%
#3,520 ml-lubich/tap/ical-mcp 7 0%
#3,521 img2pdf 7 0%
#3,522 nicksenap/grove/grove 7 0%
#3,523 hyperfine 7 0%
#3,524 commitizen 7 0%
#3,525 puleeno/openlitespeed/lsphp56 7 0%
#3,526 hughbien/tap/thyme 7 0%
#3,527 dezoomify-rs 7 0%
#3,528 libmpeg2 7 0%
#3,529 mimo-code 7 0%
#3,530 osrf/simulation/gz-math7 7 0%
#3,531 act --HEAD 7 0%
#3,532 graphviz2drawio 7 0%
#3,533 grep --HEAD 7 0%
#3,534 ayu5h-raj/tap/terminal-games 7 0%
#3,535 licensee 7 0%
#3,536 libewf 7 0%
#3,537 gasoid/photodumper/photodumper 7 0%
#3,538 gersemi 7 0%
#3,539 adapterremoval 7 0%
#3,540 lua@5.1 7 0%
#3,541 omnigent 7 0%
#3,542 david0/audio/jalv 7 0%
#3,543 statesmith 7 0%
#3,544 lgarron/lgarron/pushover --HEAD 7 0%
#3,545 awscli --HEAD 7 0%
#3,546 bossjones/tap/libav@12.3 7 0%
#3,547 tronbyt/tronbyt/libpixlet 7 0%
#3,548 octave --HEAD 7 0%
#3,549 rpds-py 7 0%
#3,550 trailbase 7 0%
#3,551 lispnik/tecgraf/tecgraf-im 7 0%
#3,552 navidrome --HEAD 7 0%
#3,553 specz-ai/tap/specz 7 0%
#3,554 brewsci/num/brewsci-scotch 7 0%
#3,555 theurichde/go-aws-sso/go-aws-sso 7 0%
#3,556 harmonybrew/core/metashell 7 0%
#3,557 shivammathur/extensions/xdebug@8.6 7 0%
#3,558 bmon 7 0%
#3,559 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-mac-metal --with-native-compilation --with-unlimited-select --with-xwidgets 7 0%
#3,560 surprisetalk/tap/slap 7 0%
#3,561 humblemonk/shurectl/shurectl 7 0%
#3,562 molecule 7 0%
#3,563 lightonai/colgrep/colgrep 7 0%
#3,564 digital-defiance/tap/bgpucap 7 0%
#3,565 harmonybrew/core/openjdk 7 0%
#3,566 zsync 7 0%
#3,567 tftp-now 7 0%
#3,568 brewsci/bio/raptor 7 0%
#3,569 uutils-coreutils 7 0%
#3,570 purplebooth/repo/git-mit 7 0%
#3,571 twio142/tap/battery 7 0%
#3,572 vet 7 0%
#3,573 richard-vd/musl-cross/musl-cross --with-aarch64 7 0%
#3,574 brewsci/bio/pplacer 7 0%
#3,575 d12frosted/emacs-plus/emacs-plus@30 --with-dbus 7 0%
#3,576 xorg-server 7 0%
#3,577 verovio 7 0%
#3,578 cppman 7 0%
#3,579 taclane/sdr/vdlm2dec 7 0%
#3,580 arustydev/tap/youtube-tui 7 0%
#3,581 jacobjiangwei/tap/mashell 7 0%
#3,582 cadical 7 0%
#3,583 tesslio/tap/tessl 7 0%
#3,584 cgns 7 0%
#3,585 nithilgadde/tap/armada --HEAD 7 0%
#3,586 earthly/earthly/earthly 7 0%
#3,587 bl4cc4t/vsplugins/vsp-bm3d --HEAD 7 0%
#3,588 gtdmmb/core/macportsrnastructviz 7 0%
#3,589 hashcat --HEAD 7 0%
#3,590 kabel/pecl/php-redis 7 0%
#3,591 wireguard-go --HEAD 7 0%
#3,592 0xjuanma/tap/helm 7 0%
#3,593 yashbhalodi/photoprune/photoprune 7 0%
#3,594 libgsf 7 0%
#3,595 tommysusanto/tap/ytalk 7 0%
#3,596 unused-code/formulae/unused --with-mimalloc 7 0%
#3,597 vapoursynth-bestsource --HEAD 7 0%
#3,598 oniguruma --HEAD 7 0%
#3,599 flux 7 0%
#3,600 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-debug --with-imagemagick --with-xwidgets 7 0%
#3,601 szibis/mlx-flash/mlx-flash 7 0%
#3,602 pgcopydb --HEAD 7 0%
#3,603 gosu 7 0%
#3,604 apache-pulsar 7 0%
#3,605 forgecode 7 0%
#3,606 icongen 7 0%
#3,607 postgresql@12 7 0%
#3,608 appwrite 7 0%
#3,609 fastapi 7 0%
#3,610 webp --HEAD 7 0%
#3,611 serena 7 0%
#3,612 qobine-tui 7 0%
#3,613 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-xwidgets 7 0%
#3,614 dhall-bash 7 0%
#3,615 minizign --HEAD 7 0%
#3,616 pgbouncer 7 0%
#3,617 git-cliff 7 0%
#3,618 kreuzberg-dev/tap/liter-llm 7 0%
#3,619 sparkworx/stuff/graphify 7 0%
#3,620 pvetui 7 0%
#3,621 mender-artifact 7 0%
#3,622 harmonybrew/core/icu4c@78 7 0%
#3,623 mbedtls --HEAD 7 0%
#3,624 cyrus-sasl --HEAD 7 0%
#3,625 digital-chemistry-laboratory/multiwfn/multiwfn --HEAD --with-openmp 7 0%
#3,626 dawidpereira/quetty/quetty 7 0%
#3,627 autosana/tap/autosana 7 0%
#3,628 brewsci/bio/harvest-tools 7 0%
#3,629 shaneatlas/thesrc/thesrc-mcp 7 0%
#3,630 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick 7 0%
#3,631 erlang-language-platform 7 0%
#3,632 gamdl 7 0%
#3,633 flyline 7 0%
#3,634 grpcui 7 0%
#3,635 mermaid-cli 7 0%
#3,636 railwaycat/emacsmacport/emacs-mac@29 --with-no-title-bars --with-spacemacs-icon 7 0%
#3,637 reduce-algebra/reduce-algebra/reduce-current 7 0%
#3,638 wow-look-at-my-code/ext-pkgs/glibc@2.41 7 0%
#3,639 grimme-lab/qc/mctc-lib 7 0%
#3,640 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-retro-gnu-meditate-levitate-icon --with-xwidgets 7 0%
#3,641 fedify 7 0%
#3,642 pdfgrep 7 0%
#3,643 d12frosted/emacs-plus/emacs-plus@29 --with-modern-doom-icon --with-native-comp 7 0%
#3,644 sol2 7 0%
#3,645 unrtf 7 0%
#3,646 riscv/riscv/riscv-openocd 7 0%
#3,647 pixi 7 0%
#3,648 steipete/tap/remindctl 7 0%
#3,649 namelocmas/mipsel-none-elf-gcc/mipsel-none-elf-gcc 7 0%
#3,650 blburns/taps/simple-smtp-mailer 7 0%
#3,651 therion/therion/therion --HEAD 7 0%
#3,652 gping 7 0%
#3,653 fortran-lang/fortran/lfortran 7 0%
#3,654 ott 7 0%
#3,655 haxe 7 0%
#3,656 data-wise/tap/aiterm 7 0%
#3,657 dciabrin/ngdevkit/ngdevkit-gngeo 7 0%
#3,658 step 7 0%
#3,659 smol-machines/tap/smolvm 7 0%
#3,660 pgloader --HEAD 7 0%
#3,661 salesforcecommercecloud/tools/b2c-cli 7 0%
#3,662 brewsci/bio/lsd2 7 0%
#3,663 pkcs11-helper --HEAD 7 0%
#3,664 fastbuild 7 0%
#3,665 steipete/tap/tmuxwatch 7 0%
#3,666 k8sgpt 7 0%
#3,667 sidaf/pentest/empire 7 0%
#3,668 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-modern-icon 7 0%
#3,669 p4puniya/macolint/macolint 7 0%
#3,670 mockery 7 0%
#3,671 uv --HEAD 7 0%
#3,672 danpashin/repo/libtatsu 7 0%
#3,673 hcxtools 7 0%
#3,674 mac-cleanup-py 7 0%
#3,675 sanjay7178/makim/makim 7 0%
#3,676 dduan/formulae/ea 7 0%
#3,677 parca 7 0%
#3,678 brewsci/bio/oma 7 0%
#3,679 cdalvaro/tap/wxwidgets --with-enable-abort 7 0%
#3,680 icecube/icecube/photospline 7 0%
#3,681 omarshahine/tap/journal-cli 7 0%
#3,682 tenstorrent/tools/tracy 7 0%
#3,683 scaryrawr/formulae/omlx --HEAD 7 0%
#3,684 spacenavd 7 0%
#3,685 avchaykin/tap/liberte-graph-v2 7 0%
#3,686 enfasis/emacs-plus/emacs-plus@30 7 0%
#3,687 theapplegates/kleopatra6mac/kf6-kcompletion 7 0%
#3,688 logcli 7 0%
#3,689 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install 7 0%
#3,690 garnet 7 0%
#3,691 yurijmikhalevich/tap/pytorch-python312@2.5.1 7 0%
#3,692 bazel-diff 7 0%
#3,693 kubernetes-cli@1.34 7 0%
#3,694 rlaope/tap/omh 7 0%
#3,695 cilium-cli 7 0%
#3,696 lldb 7 0%
#3,697 dysk 7 0%
#3,698 trinityhades/opencarstream/opencarstream 7 0%
#3,699 terraform 7 0%
#3,700 wassette 7 0%
#3,701 tueda/loops/fiesta 7 0%
#3,702 tfcollins/formulae/iio-oscilloscope --HEAD 7 0%
#3,703 gptme 7 0%
#3,704 s3fs 7 0%
#3,705 boost-python3 7 0%
#3,706 ruby@3.3 7 0%
#3,707 harmonybrew/core/mysql 7 0%
#3,708 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-gcc --with-hypre --with-openmp --with-testing --without-mumps --without-open-mpi 7 0%
#3,709 yap 7 0%
#3,710 agiliopadua/extras/xcrysden 7 0%
#3,711 kompose 7 0%
#3,712 gmerlino/edid-decode/edid-decode --HEAD 7 0%
#3,713 workerd 7 0%
#3,714 lyx@2.4 7 0%
#3,715 jessegoodier/kpf/kpf 7 0%
#3,716 cargo-bundle 7 0%
#3,717 lakekeeper 7 0%
#3,718 pay 7 0%
#3,719 qqilihq/partial-emlx-converter/partial-emlx-converter 7 0%
#3,720 todoist-cli 7 0%
#3,721 zjywill/tap/pickroom 7 0%
#3,722 gitea 7 0%
#3,723 pism/pism/netcdf-mpi 7 0%
#3,724 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-natural-title-bar --with-spacemacs-icon --with-starter 7 0%
#3,725 amar1729/deluge-meta/libtorrent-rasterbar@2.0.13 7 0%
#3,726 uzdoom 7 0%
#3,727 zfogg/ascii-chat/ascii-chat --HEAD 7 0%
#3,728 vishwakumaran/volt/volt-cli 7 0%
#3,729 llvm-hs/llvm/llvm-9 7 0%
#3,730 codeeditapp/formulae/codeedit-cli 7 0%
#3,731 archived-codacy/tap/codacy-analysis-cli 7 0%
#3,732 filosottile/musl-cross/musl-cross --without-x86_64 7 0%
#3,733 vfonov/minc/minc-toolkit-v2 7 0%
#3,734 io 7 0%
#3,735 inivation/inivation/dv-runtime 7 0%
#3,736 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-imagemagick 7 0%
#3,737 shopify/shopify/cmake30 7 0%
#3,738 jakob-bagterp/browserist/browserist 7 0%
#3,739 open-s4c/tap/vatomic 7 0%
#3,740 philpennock/protocols/sieve-connect --without-readline 7 0%
#3,741 cyrus-sasl-xoauth2 7 0%
#3,742 happenstance-ai/tap/happenstance 7 0%
#3,743 dosbox-x --HEAD 7 0%
#3,744 antoninbas/tap/knotes 7 0%
#3,745 chatblade 7 0%
#3,746 snort 7 0%
#3,747 cmake-init 7 0%
#3,748 redis@3.2.1 7 0%
#3,749 mangowhoiscloud/tap/geode 7 0%
#3,750 blockhash 7 0%
#3,751 cloudflare-cli4 7 0%
#3,752 tnishinaga/sigrok/pulseview --HEAD 7 0%
#3,753 bear10591/tap/assettool --HEAD 7 0%
#3,754 gjbauer/msp430-elf/binutils-msp430-elf 7 0%
#3,755 plural-pinelabs/pinelabs/pinelabs-mcp-server 7 0%
#3,756 rioriost/tap/aoai_proxy 7 0%
#3,757 kkdd/tap/bash44 7 0%
#3,758 cookiecutter 7 0%
#3,759 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-imagemagick --with-librsvg --with-native-comp --with-no-title-bars --with-xwidgets 7 0%
#3,760 websocat 7 0%
#3,761 agiletec-inc/tap/airiscode 7 0%
#3,762 brewsci/bio/clustal-w 7 0%
#3,763 darcs 7 0%
#3,764 felixkratz/formulae/sketchybar --HEAD 7 0%
#3,765 auterion/auterion/virtual-skynode 7 0%
#3,766 netlify-cli 7 0%
#3,767 trzsz-go 7 0%
#3,768 jruby 7 0%
#3,769 simutrans 7 0%
#3,770 marcus/tap/nightshift 7 0%
#3,771 tlan16/tap/mac-cron --HEAD 7 0%
#3,772 kabel/php-ext/php@8.2-imap 7 0%
#3,773 ctk 7 0%
#3,774 proxygen 7 0%
#3,775 sesh 7 0%
#3,776 sdcc 7 0%
#3,777 tariqwest/tap/devbox 7 0%
#3,778 fyzanshaik/tap/cachewatch 7 0%
#3,779 bbrinkerhoff/private/ejectify 7 0%
#3,780 autumnjolitz/tap/python@24 7 0%
#3,781 getsynth/synth/synth 7 0%
#3,782 uvicorn 7 0%
#3,783 btb/open-watcom/open-watcom-v2 7 0%
#3,784 pipewire 7 0%
#3,785 iflow-ai/iflow-cli/iflow-cli 7 0%
#3,786 dgarnier/plasma/mdsplus 7 0%
#3,787 faithbeam/stalker-gamma.cli/stalker-gamma-launcher.cli 7 0%
#3,788 fx 7 0%
#3,789 ggerganov/ggerganov/llama.cpp 7 0%
#3,790 ripasso 7 0%
#3,791 monero 7 0%
#3,792 patchelf 7 0%
#3,793 toxiproxy 7 0%
#3,794 brewsci/bio/fraggenescan 7 0%
#3,795 asciiquarium 7 0%
#3,796 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-mailutils --with-no-frame-refocus --with-xwidgets 7 0%
#3,797 outscale/tap/octl 7 0%
#3,798 nakamura-shuta/tij/tij 7 0%
#3,799 salilab/salilab/imp 7 0%
#3,800 container-compose 7 0%
#3,801 patthemav/custom/ffmpeg-custom 7 0%
#3,802 gap-system/gap/gap 7 0%
#3,803 muter-mutation-testing/formulae/muter 7 0%
#3,804 lsd 7 0%
#3,805 cgrep 7 0%
#3,806 jakkusakura/kde/kf5-kconfigwidgets 7 0%
#3,807 runc --HEAD 7 0%
#3,808 daniel-toman/exfat/exfat --HEAD 7 0%
#3,809 libssh2 --HEAD 7 0%
#3,810 gretel/sdr/libiio 7 0%
#3,811 libxo 7 0%
#3,812 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-libbluray 7 0%
#3,813 toonetown/extras/ips2crash --HEAD 7 0%
#3,814 pdfcrack 7 0%
#3,815 libheif-plugins 7 0%
#3,816 ntopng 7 0%
#3,817 g2o 7 0%
#3,818 socktainer --HEAD 7 0%
#3,819 arcadi4/tap/kiro.rs --HEAD 7 0%
#3,820 sidaf/pentest/aircrack-ng 6 0%
#3,821 dhall-yaml 6 0%
#3,822 topgrade 6 0%
#3,823 librefang 6 0%
#3,824 geph4 6 0%
#3,825 ntopng --HEAD 6 0%
#3,826 tirith 6 0%
#3,827 nanovms/ops/ops 6 0%
#3,828 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libplacebo --with-librsvg --with-whisper-cpp 6 0%
#3,829 fraluc06/tap/filen-cli 6 0%
#3,830 zimodrok/musicapp/musicapp 6 0%
#3,831 philpennock/protocols/sieve-connect --HEAD 6 0%
#3,832 petere/postgresql/postgresql@9.4 6 0%
#3,833 vibe-log-cli 6 0%
#3,834 lastpass-cli --HEAD 6 0%
#3,835 sri-csl/sri-csl/libpoly 6 0%
#3,836 pothosware/pothos/soapyplutosdr --HEAD 6 0%
#3,837 davidchall/hep/lhapdf 6 0%
#3,838 dutchcoders/marija/marija 6 0%
#3,839 panter-dsd/tap/tatuin 6 0%
#3,840 redwax-tool 6 0%
#3,841 dungle-scrubs/sinew/sinew 6 0%
#3,842 gmime 6 0%
#3,843 webrowse/street/romyq 6 0%
#3,844 fabric-ai 6 0%
#3,845 smith-tools/smith/smith-cli 6 0%
#3,846 gitlab-gem 6 0%
#3,847 dhall-json 6 0%
#3,848 clainstone/tap/cbirds 6 0%
#3,849 cossacklabs/tap/libthemis --with-java 6 0%
#3,850 brewsci/bio/muscle 6 0%
#3,851 thedwncmpy/notion-cli/ns 6 0%
#3,852 speedtest-go 6 0%
#3,853 adibhanna/tsm/tsm 6 0%
#3,854 noobaa/noobaa/noobaa 6 0%
#3,855 borglab/core/gtsam4.2 6 0%
#3,856 evernote2md 6 0%
#3,857 asmvik/formulae/yabai --HEAD 6 0%
#3,858 bengry/tap/md2adf 6 0%
#3,859 morpheus-lab/morpheus/morpheus --with-sbml 6 0%
#3,860 glance 6 0%
#3,861 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 6 0%
#3,862 bao 6 0%
#3,863 serf 6 0%
#3,864 qrencode 6 0%
#3,865 mikalaibarysevich/cleverswitch/cleverswitch 6 0%
#3,866 pdfcpu 6 0%
#3,867 tmate --HEAD 6 0%
#3,868 skillshare 6 0%
#3,869 gifsicle 6 0%
#3,870 blue-triangle-tech/tools/bttinstrumentor 6 0%
#3,871 interline-io/planetutils/planetutils 6 0%
#3,872 gheat1/tuistore/tuistore 6 0%
#3,873 the-openroad-project/lemon-graph/lemon-graph --HEAD 6 0%
#3,874 enarx/enarx/enarx 6 0%
#3,875 stek29/idevice/libirecovery 6 0%
#3,876 s-lang 6 0%
#3,877 archivebox/archivebox/archivebox 6 0%
#3,878 brewsci/bio/rmblast 6 0%
#3,879 paulhkang94/markview/markview 6 0%
#3,880 icestorm 6 0%
#3,881 bytehide/tap/shield-ios 6 0%
#3,882 abcyon/shellinabox/shellinabox 6 0%
#3,883 fakeroot 6 0%
#3,884 kagent 6 0%
#3,885 dyngraphlab/dyngraphlab/dynwmis 6 0%
#3,886 libvncserver 6 0%
#3,887 unnethack --HEAD 6 0%
#3,888 aws-c-mqtt 6 0%
#3,889 chroma 6 0%
#3,890 rafalgrodzinski/tap/brb 6 0%
#3,891 stek29/idevice/libideviceactivation 6 0%
#3,892 unsloth 6 0%
#3,893 acsandmann/tap/rift 6 0%
#3,894 strongswan 6 0%
#3,895 httptap 6 0%
#3,896 tenatarika/tap/vex 6 0%
#3,897 coal 6 0%
#3,898 coccinelle 6 0%
#3,899 dronenb/tap/alertmanager 6 0%
#3,900 draw-things-cli 6 0%
#3,901 llvm@12 6 0%
#3,902 libgr 6 0%
#3,903 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-xwidgets 6 0%
#3,904 lowdown 6 0%
#3,905 morpho-lang/morpho/morpho-morphoview 6 0%
#3,906 8b-is/tap/qwave-nightly --HEAD 6 0%
#3,907 jasonhotsauce/flow/flow-gtd 6 0%
#3,908 abilityai/tap/trinity-cli 6 0%
#3,909 gmrandazzo/gmr/rdock 6 0%
#3,910 prime-vector/prime-vector/open-agent-spec 6 0%
#3,911 princebharti/leakfix/leakfix 6 0%
#3,912 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-native-comp --with-no-title-bars 6 0%
#3,913 iowow 6 0%
#3,914 korrakiran/unimem/unimem 6 0%
#3,915 liblouis 6 0%
#3,916 hevi 6 0%
#3,917 squashfs 6 0%
#3,918 chadnewbry/tap/ios-appstore-screenshots 6 0%
#3,919 libultrahdr 6 0%
#3,920 pulseview --HEAD 6 0%
#3,921 erlang@26 6 0%
#3,922 mailpit 6 0%
#3,923 iraf-community/tap/iraf 6 0%
#3,924 moonfruit/tap/dash-mcp-server 6 0%
#3,925 intertwine/tap/observational-memory 6 0%
#3,926 cycode 6 0%
#3,927 ublue-os/experimental-tap/emacs-pgtk 6 0%
#3,928 nasedkinpv/tap/numr 6 0%
#3,929 linux-pam 6 0%
#3,930 autotrace 6 0%
#3,931 autumnjolitz/tap/python24 6 0%
#3,932 ensembl/external/diamond 6 0%
#3,933 oxund/morph/morph-editor 6 0%
#3,934 formula_name 6 0%
#3,935 rebar3 6 0%
#3,936 nudoku 6 0%
#3,937 pkryger/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-modern-icon --with-optimization-flags --with-starter --with-transparent-titlebar 6 0%
#3,938 mgis 6 0%
#3,939 masscan 6 0%
#3,940 gnat 6 0%
#3,941 dropbear 6 0%
#3,942 summarize --HEAD 6 0%
#3,943 obverser/zathura/zathura --HEAD 6 0%
#3,944 petere/postgresql/postgresql@17 6 0%
#3,945 sc0rch/tools/tuist-ewa 6 0%
#3,946 drill 6 0%
#3,947 marioschwalbe/gcc-musl-cross/gcc-8-musl-cross 6 0%
#3,948 vapoursynth --HEAD 6 0%
#3,949 libjodycode 6 0%
#3,950 nagios 6 0%
#3,951 anisurrahmann/tap/call-copilot 6 0%
#3,952 smlnj 6 0%
#3,953 katana 6 0%
#3,954 xcsift 6 0%
#3,955 bozdemir/tap/claude-usage-widget 6 0%
#3,956 tush1609/system-agent/system-agent 6 0%
#3,957 ios-webkit-debug-proxy 6 0%
#3,958 zellij --HEAD 6 0%
#3,959 beagle 6 0%
#3,960 shivammathur/extensions/newrelic@8.1 6 0%
#3,961 cxwx/cxbrew/texpresso 6 0%
#3,962 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 6 0%
#3,963 pkgconf --HEAD 6 0%
#3,964 autossh 6 0%
#3,965 copyparty 6 0%
#3,966 dfla-me/scrop/scrop 6 0%
#3,967 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-imagemagick --with-xwidgets 6 0%
#3,968 daviderestivo/emacs-head/emacs-head@29 --with-cocoa --with-imagemagick --with-native-comp --with-native-full-aot --with-no-frame-refocus --with-pdumper --with-tree-sitter --with-xwidgets 6 0%
#3,969 kuttl 6 0%
#3,970 branch10480/tap/markdownobserver-fork --HEAD 6 0%
#3,971 pgstream 6 0%
#3,972 moda-labs/modastack/modastack 6 0%
#3,973 openrtm/openrtm2/openrtm2-python-py312 6 0%
#3,974 davidchall/hep/thepeg 6 0%
#3,975 mcp-atlassian 6 0%
#3,976 satishbabariya/tap/sandbox --HEAD 6 0%
#3,977 tssh 6 0%
#3,978 max2github/msh/ghdl 6 0%
#3,979 cartman-kai/thrift/thrift@0.13 6 0%
#3,980 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-purple-flat-icon 6 0%
#3,981 ericfortis/fcpscene/fcpscene 6 0%
#3,982 seal 6 0%
#3,983 inspircd 6 0%
#3,984 graalvm@25 6 0%
#3,985 croaring 6 0%
#3,986 robbielyman/seamstress/seamstress@2 6 0%
#3,987 pkcs11-tools 6 0%
#3,988 gromgit/fuse/squashfuse-mac 6 0%
#3,989 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-native-compilation 6 0%
#3,990 render-oss/render/render 6 0%
#3,991 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-no-title-bars --with-starter 6 0%
#3,992 pothosware/pothos/soapynetsdr 6 0%
#3,993 harmonybrew/core/mp3check 6 0%
#3,994 containerd 6 0%
#3,995 yuzh98/latex2arxiv/latex2arxiv 6 0%
#3,996 lorenzosim/cutechess/cutechess 6 0%
#3,997 cjson 6 0%
#3,998 redex --HEAD 6 0%
#3,999 freecad/freecad/opencamlib 6 0%
#4,000 itsashishupadhyay/mta/mta 6 0%
#4,001 hanthor/experimental-tap/blesh 6 0%
#4,002 dgarnier/plasma/zoltan 6 0%
#4,003 alsa-utils 6 0%
#4,004 willyv3/tap/agentdl 6 0%
#4,005 sidneys/homebrew/youtube-dl 6 0%
#4,006 sidaf/pentest/praeda 6 0%
#4,007 libebml 6 0%
#4,008 sonarqube-cli 6 0%
#4,009 brewsci/bio/r2r 6 0%
#4,010 bluetui 6 0%
#4,011 fengyunyongjie/tap/ios-resign 6 0%
#4,012 gtk4 --HEAD 6 0%
#4,013 coin-or-tools/coinor/ampl-mp@3.1.0 6 0%
#4,014 pranav-iiitdm/tap/gitfolio 6 0%
#4,015 sass/sass/migrator 6 0%
#4,016 sahil87/tap/tu 6 0%
#4,017 d12frosted/emacs-plus/emacs-plus@29 --with-spacemacs-icon 6 0%
#4,018 pitchfork 6 0%
#4,019 nesc 6 0%
#4,020 pdm 6 0%
#4,021 bl4cc4t/vsplugins/vsp-fmtconv --HEAD 6 0%
#4,022 aeongames/ports/skia-aeongui 6 0%
#4,023 d12frosted/emacs-plus/emacs-plus@30 --with-no-frame-refocus 6 0%
#4,024 witr 6 0%
#4,025 arping 6 0%
#4,026 k9s --HEAD 6 0%
#4,027 aureliensibiril/portal/portal 6 0%
#4,028 fsearch 6 0%
#4,029 tailwindcss 6 0%
#4,030 envkey/envkey/envkey-source 6 0%
#4,031 libraw 6 0%
#4,032 tomoima525/sotto/sotto 6 0%
#4,033 miguelriotinto/clauderelay/clauderelay 6 0%
#4,034 swiftxcode/swiftxcode/swift-progress 6 0%
#4,035 unoconv 6 0%
#4,036 lm-eval 6 0%
#4,037 chicks-net/freelawproject/x-ray 6 0%
#4,038 rafifos/tap/airsync-mac 6 0%
#4,039 turso 6 0%
#4,040 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libvmaf --with-svt-av1 6 0%
#4,041 takuya-isbs/taptest/oidc-agent 6 0%
#4,042 simonw/llm/strip-tags 6 0%
#4,043 abcm2ps 6 0%
#4,044 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-pen-icon --with-xwidgets 6 0%
#4,045 dillo 6 0%
#4,046 fernandotcl/fernandotcl/btag 6 0%
#4,047 opencascade 6 0%
#4,048 upa/tap/mscp 6 0%
#4,049 2ykwang/2ykwang/lac-py 6 0%
#4,050 macaulay2/tap/macaulay2 --HEAD 6 0%
#4,051 actapia/cibuildwheel_packages/boost-python-cibuildwheel 6 0%
#4,052 inventlist/tap/localvault 6 0%
#4,053 monit 6 0%
#4,054 zrok 6 0%
#4,055 megahit 6 0%
#4,056 sortmerna 6 0%
#4,057 cargo-depgraph 6 0%
#4,058 jo95017/openclaudia/simplefocstudio 6 0%
#4,059 coremltools 6 0%
#4,060 kaito-tokyo/kaito-tokyo/kaito-tokyo-onnxruntime@1.24.4 6 0%
#4,061 timrogers/tap/formanator 6 0%
#4,062 simonzxm/tap/deepseek-harness 6 0%
#4,063 betterleaks 6 0%
#4,064 quasor/wail/wail 6 0%
#4,065 brewsci/bio/bmdca 6 0%
#4,066 mcphost 6 0%
#4,067 hughbien/tap/mark --HEAD 6 0%
#4,068 pypy 6 0%
#4,069 eg013ra1n/rustafits/rustafits 6 0%
#4,070 autopsy 6 0%
#4,071 petere/postgresql/postgresql@9.2 6 0%
#4,072 calceph 6 0%
#4,073 serpapi/tap/serpapi-cli 6 0%
#4,074 arksigma/tap/quacktui 6 0%
#4,075 bitpeppr/formulae/rabbithole 6 0%
#4,076 agent-sh/agnix/agnix 6 0%
#4,077 volllly/tap/rotz 6 0%
#4,078 dgarnier/plasma/netcdf-fortran-mpi 6 0%
#4,079 kreeblah/flashprog-tap/flashprog 6 0%
#4,080 tronbyt-server 6 0%
#4,081 ketan-k17/clii/clii 6 0%
#4,082 brewsci/num/brewsci-parmetis 6 0%
#4,083 fnox 6 0%
#4,084 tqm 6 0%
#4,085 vjeantet/tap/libxmlsec 6 0%
#4,086 sunshine-fffergal --HEAD 6 0%
#4,087 harmonybrew/core/aws-sdk-cpp 6 0%
#4,088 awww 6 0%
#4,089 libdrm 6 0%
#4,090 pod2man 6 0%
#4,091 fileworks/tap/immich-export 6 0%
#4,092 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 6 0%
#4,093 enclavum/tap/otaku 6 0%
#4,094 gammu 6 0%
#4,095 prdash/prdash/prdash 6 0%
#4,096 ibrikin/tap/pngpaste 6 0%
#4,097 thomasqbrady/remarkable/rmcal 6 0%
#4,098 vinn-ie/openems/openems --HEAD 6 0%
#4,099 idleberg/asahi/dent --HEAD 6 0%
#4,100 gm5dna/amateur-radio/wsjtz 6 0%
#4,101 nano 6 0%
#4,102 graelo/tap/lean-ctx 6 0%
#4,103 fzj-jsc/scalasca/cubew 6 0%
#4,104 objfw 6 0%
#4,105 akatmks/vapoursynth-plugins/vapoursynth-lsmas-ffmpeg-8 --HEAD 6 0%
#4,106 itpp 6 0%
#4,107 tomas-lejdung/gopeep/gopeep 6 0%
#4,108 poppler-qt5 6 0%
#4,109 mcfearsome/tap/ghostty-styles 6 0%
#4,110 redis --HEAD 6 0%
#4,111 sdaas/tap/brew-demo 6 0%
#4,112 jordancoin/tap/codemap 6 0%
#4,113 growlyx/tap/tailmux 6 0%
#4,114 quazip 6 0%
#4,115 luau 6 0%
#4,116 symfony-cli 6 0%
#4,117 filoucrackeur/inedit-cli/inedit-cli 6 0%
#4,118 lammps 6 0%
#4,119 hyperboliclabs/hyperbolic/hyperbolic 6 0%
#4,120 ajrosen/tap/icalpal 6 0%
#4,121 scw 6 0%
#4,122 lazygit --HEAD 6 0%
#4,123 sem-cli 6 0%
#4,124 openclaw/tap/crawlbar 6 0%
#4,125 cargo-llvm-cov 6 0%
#4,126 graelo/tap/pumas 6 0%
#4,127 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-xwidgets 6 0%
#4,128 dbus --HEAD 6 0%
#4,129 arp-scan 6 0%
#4,130 wundergraph/cosmo/wgc 6 0%
#4,131 shifuairesearch/tap/gif-generator 6 0%
#4,132 ublue-os/experimental-tap/libgda 6 0%
#4,133 botfather/tap/mlxvm 6 0%
#4,134 legambiart/wtmcp/wtmcp 6 0%
#4,135 nentor/tap/dsh 6 0%
#4,136 tlk/imagemagick-x11/imagemagick 6 0%
#4,137 zhangwenqiang-dev/tools/cm 6 0%
#4,138 codecov-cli 6 0%
#4,139 shivammathur/php/php@7.3-zts 6 0%
#4,140 php@5.6 6 0%
#4,141 codingsushi79/bsh/bsh 6 0%
#4,142 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libdvdnav --with-libdvdread 6 0%
#4,143 mkdocs 6 0%
#4,144 dgarnier/plasma/fidasim 6 0%
#4,145 vladistan/gizmos/image-creator-tool 6 0%
#4,146 namanjn98/ai-advisory/ai-advisory 6 0%
#4,147 arcadi4/tap/markitdown 6 0%
#4,148 talosctl 6 0%
#4,149 ngspice 6 0%
#4,150 doh 6 0%
#4,151 kryptco/tap/kr 6 0%
#4,152 dpo/openblas/mumps 6 0%
#4,153 vrpn 6 0%
#4,154 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-ctags --with-dbus --with-imagemagick --with-mailutils 6 0%
#4,155 kayyo321/kleopatra4mac/kleopatra 6 0%
#4,156 tesseract --HEAD 6 0%
#4,157 rfidresearchgroup/proxmark3/proxmark3 --without-qt@5 6 0%
#4,158 gnuradio --HEAD 6 0%
#4,159 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-imagemagick --with-modern-icon-sjrmanning --with-native-comp --with-native-full-aot --with-pdumper --with-tree-sitter 6 0%
#4,160 oldcrow/macos13-fixes/gnutls 6 0%
#4,161 aqbanking 6 0%
#4,162 tbox 6 0%
#4,163 timidity 6 0%
#4,164 sqitchers/sqitch/sqitch --with-mysql-support --with-postgres-support --with-sqlite-support 6 0%
#4,165 morphe 6 0%
#4,166 supermin 6 0%
#4,167 agiletec-inc/tap/airis-mcp-gateway 6 0%
#4,168 jj 6 0%
#4,169 jakkusakura/kde/kf5-ki18n 6 0%
#4,170 railwaycat/emacsmacport/emacs-mac@29 --with-starter 6 0%
#4,171 text-embeddings-inference 6 0%
#4,172 mago 6 0%
#4,173 grimme-lab/qc/mstore 6 0%
#4,174 corsixth 6 0%
#4,175 nx 6 0%
#4,176 dgarnier/plasma/m3dc1 6 0%
#4,177 lautarovculic/ioscpy/ioscpy 6 0%
#4,178 flow 6 0%
#4,179 librcsc 6 0%
#4,180 lesmiscore/my/ytdl-patched 6 0%
#4,181 hyphatech/jailrun/jailrun 6 0%
#4,182 rbenv/tap/openssl@1.0 6 0%
#4,183 kris-anderson/netperf/netperf-enable-demo --HEAD 6 0%
#4,184 sunshinejr/formulae/pouch 6 0%
#4,185 felangel/mason/mason 6 0%
#4,186 electric 6 0%
#4,187 macmade/tap/smc-dump --HEAD 6 0%
#4,188 cpdf 6 0%
#4,189 microsoft/mssql-release/msodbcsql 6 0%
#4,190 kiesel 6 0%
#4,191 bra 6 0%
#4,192 cgit 6 0%
#4,193 yarn-berry 6 0%
#4,194 mrbayes 6 0%
#4,195 tracker 6 0%
#4,196 telnetd 6 0%
#4,197 osmium-tool 6 0%
#4,198 gaberealb/psx-dev/mips-linux-gnu-gcc 6 0%
#4,199 akatmks/vapoursynth-plugins/vapoursynth-bestsource --HEAD 6 0%
#4,200 jessecanderson/tap/cyberdeck 6 0%
#4,201 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon 6 0%
#4,202 octave-app/octave-app/qscintilla2-qt5 6 0%
#4,203 tudelft3d/software/val3dity 6 0%
#4,204 nicarl/somafm/somafm 6 0%
#4,205 stek29/idevice/idevicerestore 6 0%
#4,206 shivammathur/extensions/swoole@7.0 6 0%
#4,207 deadsimple-xyz/tap/carl 6 0%
#4,208 kaito-tokyo/kaito-tokyo/kaito-tokyo-python@3.11 6 0%
#4,209 harmonybrew/core/magic_enum 6 0%
#4,210 harmonybrew/core/parallel-hashmap 6 0%
#4,211 elkraneo/tap/spmsift 6 0%
#4,212 sickchill 6 0%
#4,213 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-xwidgets 6 0%
#4,214 duti 6 0%
#4,215 raptor 6 0%
#4,216 ngt 6 0%
#4,217 petsc 6 0%
#4,218 charlexh/tap/code-buddy 6 0%
#4,219 cloudflare-wrangler 6 0%
#4,220 netlas-io/netlas/netlas 6 0%
#4,221 galenomoon/tap/tada 6 0%
#4,222 yazidears/wiiu/gamepad-bridge 6 0%
#4,223 gcli 6 0%
#4,224 scaryrawr/formulae/omlx --HEAD --with-audio --with-custom-kernel --with-grammar --with-image 6 0%
#4,225 coilysiren/tap/arize-phoenix 6 0%
#4,226 link-coder100788/java-sdl2/java-sdl2 6 0%
#4,227 libcap 6 0%
#4,228 davelet/gim/git-intelligence-message 6 0%
#4,229 fish --HEAD 6 0%
#4,230 miguelarios/tap/macos-calendar-mcp --HEAD 6 0%
#4,231 serpentiel/tools/betterglobekey 6 0%
#4,232 libsql/sqld/sqld-beta 6 0%
#4,233 dustinkirkland/trustmux/trustmux 6 0%
#4,234 neelashkannan/ros-installer/ros2-installer 6 0%
#4,235 agammemnon/tap/libotf 6 0%
#4,236 d12frosted/emacs-plus/emacs-plus@31 --with-modern-alecive-flatwoken-icon 6 0%
#4,237 bench 6 0%
#4,238 brewsci/bio/exabayes 6 0%
#4,239 roots/tap/trellis-cli 6 0%
#4,240 narugit/smctemp/smctemp 6 0%
#4,241 kartverket/taps/gdal-openfyba 6 0%
#4,242 torrra 6 0%
#4,243 d12frosted/emacs-plus/emacs-plus@29 --with-debug --with-xwidgets 6 0%
#4,244 chisel 6 0%
#4,245 leaf-markdown-viewer 6 0%
#4,246 cartman-kai/thrift/thrift@0.23 6 0%
#4,247 brewsci/science/mathgl 6 0%
#4,248 age-plugin-se --HEAD 6 0%
#4,249 cryptol 6 0%
#4,250 brewsci/bio/concavity 6 0%
#4,251 wernerturing/multi-delogo/multi-delogo 6 0%
#4,252 technitium-library 6 0%
#4,253 dalfox 6 0%
#4,254 flashrom 6 0%
#4,255 atombender/ktail/ktail 6 0%
#4,256 matsunagalab/genesis/genesis 6 0%
#4,257 nativeos/i386-elf-toolchain/i386-elf-gcc@11.2 6 0%
#4,258 harmonybrew/core/azure-storage-common-cpp 6 0%
#4,259 flac 6 0%
#4,260 weiesky/cc-viewer/cc-viewer 6 0%
#4,261 akku 6 0%
#4,262 mininglamp-ai/tap/mano-afk 6 0%
#4,263 shivammathur/php/php@5.6-zts 6 0%
#4,264 iltommi/brews/pango 6 0%
#4,265 llgo 6 0%
#4,266 cartert27/tap/ticktick-cli 6 0%
#4,267 lna-dev/tap/ytdlp-nfo 6 0%
#4,268 seanhoughton/astronomy/libnova 6 0%
#4,269 texasbe2trill/tap/macos-trust 6 0%
#4,270 jdpedrie/php55/php@5.5 6 0%
#4,271 david0/audio/ardour6 6 0%
#4,272 quic/quic/libguestfs 6 0%
#4,273 conduktor/brew/conduktor-cli 6 0%
#4,274 z80oolong/eaw/nano@9999-dev 6 0%
#4,275 florinm03/zathura/zathura 6 0%
#4,276 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-librsvg --with-native-compilation --with-natural-title-bar --with-starter 6 0%
#4,277 fincognition/powertools/powertools-ai 6 0%
#4,278 chipsalliance/verible/verible --HEAD 5 0%
#4,279 docker-agent 5 0%
#4,280 icecube/icecube/nuflux 5 0%
#4,281 flowpipe 5 0%
#4,282 brewsci/bio/snp-dists 5 0%
#4,283 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-dbus --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-native-comp --with-natural-title-bar --with-xwidgets 5 0%
#4,284 jnethack 5 0%
#4,285 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --with-native-comp --with-starter 5 0%
#4,286 lapack 5 0%
#4,287 arb-project/arb/perl@5.36 5 0%
#4,288 osrf/simulation/gz-common6 5 0%
#4,289 libnice 5 0%
#4,290 pkryger/emacsmacport-exp/emacs-mac-exp@31 --HEAD --with-arc --with-dbus --with-glib --with-imagemagick --with-modern-icon --with-optimization-flags --with-unlimited-select 5 0%
#4,291 openslide 5 0%
#4,292 muonium-ai/send2trash/send2trash 5 0%
#4,293 powerset-co/powerset/contact-exporter 5 0%
#4,294 jank-lang/jank/jank-git 5 0%
#4,295 trsvsr/aerie/aerie 5 0%
#4,296 threatdeck 5 0%
#4,297 omniorb 5 0%
#4,298 pngquant --HEAD 5 0%
#4,299 frankfu916/tap/highwater 5 0%
#4,300 c0rmac/isomorphism/isomorphism-mlx 5 0%
#4,301 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-mailutils --with-nobu417-big-sur-icon 5 0%
#4,302 sbryngelson/mfc/mfc 5 0%
#4,303 garage 5 0%
#4,304 justinschuldt/virt-manager/virt-viewer 5 0%
#4,305 gogcli --HEAD 5 0%
#4,306 justintime50/formulas/github-archive 5 0%
#4,307 saml2aws 5 0%
#4,308 the-ai-cowboys-projects/bronco/bronco 5 0%
#4,309 hlint 5 0%
#4,310 envio 5 0%
#4,311 pytr 5 0%
#4,312 chrony 5 0%
#4,313 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-mailutils --with-native-comp --with-xwidgets 5 0%
#4,314 libgit2 --HEAD 5 0%
#4,315 jartza/fireminipro/fireminipro 5 0%
#4,316 d12frosted/emacs-plus/emacs-plus@30 --with-modern-icon --with-xwidgets 5 0%
#4,317 harmonybrew/core/ollama 5 0%
#4,318 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 5 0%
#4,319 zzmarks26/zcompact/zcompact 5 0%
#4,320 blake3 5 0%
#4,321 enchant 5 0%
#4,322 ronn-ng 5 0%
#4,323 wossfoss/vapoursynth/vapoursynth-bm3dmetal 5 0%
#4,324 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-spacemacs-icon --with-xwidgets 5 0%
#4,325 espeak 5 0%
#4,326 oh-my-posh --HEAD 5 0%
#4,327 tinymist 5 0%
#4,328 sox 5 0%
#4,329 kahip/kahip/clustre 5 0%
#4,330 lego 5 0%
#4,331 cartman-kai/thrift/thrift@0.16 5 0%
#4,332 glances 5 0%
#4,333 dehancer/brew/webp_dehancer 5 0%
#4,334 clxrityy/tap/rawget 5 0%
#4,335 beshrns/mspgcc/msp430-binutils 5 0%
#4,336 forge-rubigd/sshpilot/sshpilot 5 0%
#4,337 railwaycat/emacsmacport/emacs-mac@29 --with-modern-icon --with-native-compilation 5 0%
#4,338 mikhayloboikodev/cli-tools/ftc 5 0%
#4,339 cronboard 5 0%
#4,340 brewsci/science/p4est 5 0%
#4,341 zephyr-cheung/tap/soda-lyrics 5 0%
#4,342 python-lsp-server 5 0%
#4,343 aws-elasticbeanstalk 5 0%
#4,344 benesch/os161/os161-gdb 5 0%
#4,345 vulkan-validationlayers 5 0%
#4,346 antonme/tap/mosh 5 0%
#4,347 estephanobrusa/canirun/canirun 5 0%
#4,348 tig 5 0%
#4,349 data-desk-eco/tap/sift --HEAD 5 0%
#4,350 libxrender 5 0%
#4,351 david0/audio/lv2vst --HEAD 5 0%
#4,352 freeglut 5 0%
#4,353 xmlrpc-c 5 0%
#4,354 sidaf/pentest/inception 5 0%
#4,355 aiyouwolegequ/tap/calctokens 5 0%
#4,356 pothosware/pothos/pothos --HEAD 5 0%
#4,357 brightness --HEAD 5 0%
#4,358 harmonybrew/core/openjdk@17 5 0%
#4,359 ansible@12 5 0%
#4,360 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 5 0%
#4,361 pallotron/pvmlab/pvmlab 5 0%
#4,362 netspeed-cli 5 0%
#4,363 tomahawk-player/tomahawkqt5/extracmakemodules --HEAD 5 0%
#4,364 fmidev/smartmet/smartmet-library-macgyver 5 0%
#4,365 richardlehane/digipres/siegfried 5 0%
#4,366 zeek/zeek/spicy --HEAD 5 0%
#4,367 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-no-frame-refocus --with-savchenkovaleriy-big-sur-icon --with-xwidgets 5 0%
#4,368 kamilturek/python2/python@2 5 0%
#4,369 go-air 5 0%
#4,370 ecstasoy/scrobbler/scrobbler 5 0%
#4,371 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 5 0%
#4,372 forgejo-cli 5 0%
#4,373 tlan16/tap/bruno --HEAD 5 0%
#4,374 yoggy/sendosc/sendosc 5 0%
#4,375 umars28/tap/sshm 5 0%
#4,376 fourmolu 5 0%
#4,377 osrf/simulation/sdformat16 5 0%
#4,378 aider --HEAD 5 0%
#4,379 harmonybrew/core/python@3.12 5 0%
#4,380 klee 5 0%
#4,381 lucataco/tap/parakeet-cli 5 0%
#4,382 pcapmirror 5 0%
#4,383 ennogtal/proxmark3/proxmark3 5 0%
#4,384 airshare 5 0%
#4,385 shivammathur/extensions/mongodb@8.6 5 0%
#4,386 alphagov/gds/gds-cli 5 0%
#4,387 d12frosted/emacs-plus/emacs-plus@29 --with-debug --with-imagemagick --with-native-comp --with-xwidgets 5 0%
#4,388 gromgit/fuse/xmount-mac 5 0%
#4,389 minipro 5 0%
#4,390 xrootd 5 0%
#4,391 turnonac/drive-reorganizer/drive-reorganizer 5 0%
#4,392 projectm 5 0%
#4,393 fortrangoingonforty/facsimile/facsimile 5 0%
#4,394 z80oolong/eaw/rxvt-unicode@9.31 5 0%
#4,395 dvodnenko/raw/raw 5 0%
#4,396 sane-backends --HEAD 5 0%
#4,397 mingyu3360715/system-deps-fork/alibuild 5 0%
#4,398 actions-languageserver 5 0%
#4,399 drawio-desktop 5 0%
#4,400 wasmtime 5 0%
#4,401 bcftools 5 0%
#4,402 piecodepl/tap/codex-ai-center 5 0%
#4,403 linode-cli 5 0%
#4,404 sidneys/homebrew/optool 5 0%
#4,405 argp-standalone 5 0%
#4,406 mbedtls 5 0%
#4,407 railwaycat/emacsmacport/emacs-mac@29 --with-modern-icon --with-native-comp 5 0%
#4,408 dlr-ts/sumo/sumo@1.0.1 5 0%
#4,409 vapoursynth-bestsource 5 0%
#4,410 kulesh/tap/waypoints 5 0%
#4,411 liwmj/ghlink/ghlink 5 0%
#4,412 matchylabs/matchy/matchy 5 0%
#4,413 mxcl/made/swift-sh 5 0%
#4,414 wxmaxima --HEAD 5 0%
#4,415 osgeo/osgeo4mac/osgeo-proj 5 0%
#4,416 gitte 5 0%
#4,417 siliconwitchery/oss-fpga/nextpnr-nexus --HEAD 5 0%
#4,418 avsm/ocaml/oxmono 5 0%
#4,419 brewsci/bio/nanofilt 5 0%
#4,420 antomicblitz/deepvariant/deepvariant 5 0%
#4,421 quodeq/tap/quodeq 5 0%
#4,422 jcode 5 0%
#4,423 thepixelabs/tap/rover 5 0%
#4,424 anidl-multi-downloader-nx 5 0%
#4,425 graphviz --HEAD 5 0%
#4,426 bl4cc4t/vsplugins/vsp-eedi3 5 0%
#4,427 mobile-dev-inc/tap/xcodes 5 0%
#4,428 sqldef/sqldef/mysqldef 5 0%
#4,429 zigup 5 0%
#4,430 superatomic/tap/tldr-man 5 0%
#4,431 shivammathur/extensions/v8js@8.6 5 0%
#4,432 mistertea/et/et --HEAD 5 0%
#4,433 ainative-studio/tap/cody 5 0%
#4,434 fceux --HEAD 5 0%
#4,435 oscaro/public/edn2json 5 0%
#4,436 vleonbonnet/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-dbus --with-imagemagick --with-mac-metal --with-modern-icon --with-no-title-bars --with-starter --with-unlimited-select --with-xwidgets 5 0%
#4,437 osgeo/osgeo4mac/osgeo-gdal 5 0%
#4,438 gazelle 5 0%
#4,439 dyx884877791/i386-jos-elf-gcc/i386-jos-elf-gcc 5 0%
#4,440 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 5 0%
#4,441 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-native-compilation --with-starter --with-xwidgets 5 0%
#4,442 fgrmt/wallpapper/wallpapper 5 0%
#4,443 shivammathur/extensions/uopz@8.5 5 0%
#4,444 mercury-cli 5 0%
#4,445 fwyit/tools/cmake 5 0%
#4,446 outscale/tap/oapi-cli 5 0%
#4,447 schollz/tap/oooooooo 5 0%
#4,448 shivammathur/php/php@7.3-debug 5 0%
#4,449 ntfy 5 0%
#4,450 ble.sh 5 0%
#4,451 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-natural-title-bar 5 0%
#4,452 digitable-lol/tap/flang 5 0%
#4,453 namolnad/formulae/jt 5 0%
#4,454 eblot/armeabi/arm-none-eabi-llvm 5 0%
#4,455 osrf/simulation/gz-rotary-sim --HEAD 5 0%
#4,456 bl4cc4t/vsplugins/vsp-mvtools --HEAD 5 0%
#4,457 slepc 5 0%
#4,458 aamath 5 0%
#4,459 screen --HEAD 5 0%
#4,460 dim-gggl/clinkey-cli/clinkey-cli 5 0%
#4,461 yp583/custom-git/custom-git 5 0%
#4,462 phalt/clientele/clientele 5 0%
#4,463 neomutt --HEAD 5 0%
#4,464 anthrotype/ttfautohint/ttfautohintgui 5 0%
#4,465 terraform-provider-libvirt 5 0%
#4,466 lifepillar/appleii/wozardry 5 0%
#4,467 roelofrossouw/sc/simply-cpp-ai 5 0%
#4,468 mapmap 5 0%
#4,469 zenity 5 0%
#4,470 oiwn/tap/tarts 5 0%
#4,471 lief 5 0%
#4,472 harmonybrew/core/boost 5 0%
#4,473 benmorrisrains/kpm/kpm 5 0%
#4,474 d12frosted/emacs-plus/emacs-plus@29 --with-ctags --with-imagemagick --with-native-comp --with-xwidgets 5 0%
#4,475 texmath 5 0%
#4,476 shivammathur/extensions/uopz@8.6 5 0%
#4,477 h2o 5 0%
#4,478 sqldef/sqldef/sqlite3def 5 0%
#4,479 dravr-ai/tap/embacle-ffi 5 0%
#4,480 pandoc --HEAD 5 0%
#4,481 shivammathur/extensions/redis@8.6 5 0%
#4,482 git-custom 5 0%
#4,483 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-nuvola-icon --with-xwidgets 5 0%
#4,484 youngcan-wang/wyckoff/wyckoff 5 0%
#4,485 elmercsc/elmerfem/elmer --HEAD --with-elmergui --without-mumps 5 0%
#4,486 willyv3/tap/gittui 5 0%
#4,487 calebthecm/mindvault/mindvault 5 0%
#4,488 philpennock/protocols/sieve-connect --with-brew-perl 5 0%
#4,489 gromgit/fuse/encfs-mac 5 0%
#4,490 mickeyl/formulae/wellenreiter-cli 5 0%
#4,491 mohankrishnaalavala/context-router/context-router 5 0%
#4,492 brewsci/bio/tmalign 5 0%
#4,493 deus0ww/tap/mpv --HEAD 5 0%
#4,494 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus 5 0%
#4,495 sy1vain/ffmpeg/ffmpeg@3.4 5 0%
#4,496 xiw/jos/i386-jos-elf-binutils 5 0%
#4,497 liblo 5 0%
#4,498 gdcm 5 0%
#4,499 kp-krisnop/flatcam-evo/flatcam-evo 5 0%
#4,500 francofrizzo/tap/label 5 0%
#4,501 termscp 5 0%
#4,502 d12frosted/emacs-plus/emacs-plus@30 --with-c9rgreen-sonoma-icon 5 0%
#4,503 woof-doom 5 0%
#4,504 open-scene-graph 5 0%
#4,505 bengieeee/aws-google-saml/aws-google-saml 5 0%
#4,506 rene-dev/sigrok/libsigrok 5 0%
#4,507 ethereum/ethereum/solidity@6 5 0%
#4,508 tecolicom/tap/app-ansicolumn 5 0%
#4,509 brewsci/bio/r8s 5 0%
#4,510 notunrandom/cardano/cardano-node 5 0%
#4,511 harmonybrew/core/rust-analyzer 5 0%
#4,512 harmonybrew/core/procps 5 0%
#4,513 mdave/nektar/nektar 5 0%
#4,514 valhalla/valhalla/valhalla --without-boost-python 5 0%
#4,515 pcresswell/tap/macmail 5 0%
#4,516 uttujod/ralph/ralph-orchestrator 5 0%
#4,517 arustydev/tap/hex-patch 5 0%
#4,518 llvm@15 5 0%
#4,519 vtcode 5 0%
#4,520 zoubenjia/tap/sit-monitor 5 0%
#4,521 gcc@11 5 0%
#4,522 nejohnson2/sdr/bladerf --HEAD 5 0%
#4,523 helix 5 0%
#4,524 yuhaiin/yuhaiin/yuhaiin 5 0%
#4,525 sidaf/pentest/the_harvester 5 0%
#4,526 wasm-bindgen 5 0%
#4,527 xiaohk/clip2imgur/clip2imgur 5 0%
#4,528 harmonybrew/core/mecab 5 0%
#4,529 xurls 5 0%
#4,530 grep 5 0%
#4,531 cryptography --HEAD 5 0%
#4,532 maif/daikoku/daikoku 5 0%
#4,533 hyano/sigrok/pulseview --HEAD 5 0%
#4,534 morii0v0/core/openvpn3 5 0%
#4,535 ex-vi 5 0%
#4,536 thefranco2/tips/tips 5 0%
#4,537 0xlxx/tap/pdfsearch 5 0%
#4,538 msitools 5 0%
#4,539 tini 5 0%
#4,540 d12frosted/emacs-plus/emacs-plus@32 --with-compress-install --with-xwidgets 5 0%
#4,541 vite 5 0%
#4,542 oxipng 5 0%
#4,543 rgsystemes/qt4/unixodbc --with-universal 5 0%
#4,544 oschrenk/made/keyboard 5 0%
#4,545 osrf/simulation/ignition-gazebo6 5 0%
#4,546 vals 5 0%
#4,547 tanmaypatil105/tap/wifi-cli 5 0%
#4,548 yzuyr/notesse/notesse 5 0%
#4,549 ssulser/local/gnucobol-svn --HEAD 5 0%
#4,550 sentry-native 5 0%
#4,551 jussinokelainen/cldl/cldl 5 0%
#4,552 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zimg 5 0%
#4,553 gromgit/dev/fry 5 0%
#4,554 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark --with-flash --with-smartcard 5 0%
#4,555 vampire 5 0%
#4,556 brewsci/bio/metabuli 5 0%
#4,557 zim --HEAD 5 0%
#4,558 bic 5 0%
#4,559 nightwatcher314/formula/zotero-pdf2zh 5 0%
#4,560 joaquimserafim/ora/ora 5 0%
#4,561 pasrom/meeting-transcriber/meeting-transcriber --HEAD 5 0%
#4,562 qsv 5 0%
#4,563 yingshu0218/toolbox/toolbox 5 0%
#4,564 astralcollar/mish/mish 5 0%
#4,565 joeygibson/tools/jsonquill 5 0%
#4,566 hypre 5 0%
#4,567 cmake --HEAD 5 0%
#4,568 brewsci/num/brewsci-mumps --without-brewsci-parmetis 5 0%
#4,569 zeroc-ice/tap/berkeley-db@5.3 5 0%
#4,570 component 5 0%
#4,571 c-blosc2 5 0%
#4,572 fleet-cli 5 0%
#4,573 sbom-utility 5 0%
#4,574 erishell 5 0%
#4,575 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-xwidgets 5 0%
#4,576 rioriost/tap/envrcctl 5 0%
#4,577 passenger 5 0%
#4,578 giza 5 0%
#4,579 cxwx/cxbrew/tqdm 5 0%
#4,580 ldomaradzki/xctree/xctree 5 0%
#4,581 linfan/cloudflare/curl 5 0%
#4,582 dbmate 5 0%
#4,583 ionclaw-org/tap/ionclaw --HEAD 5 0%
#4,584 ninefiveb/ybar/ybar 5 0%
#4,585 railwaycat/emacsmacport/emacs-mac@29 --with-xwidgets 5 0%
#4,586 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-starter 5 0%
#4,587 noseyparker 5 0%
#4,588 libmaxminddb 5 0%
#4,589 d12frosted/emacs-plus/emacs-plus@30 --with-modern-nuvola-icon 5 0%
#4,590 auth0 5 0%
#4,591 nintexplatform/versions/kubernetes-cli@1.20.0 5 0%
#4,592 yhkl-dev/navicli/navicli 5 0%
#4,593 doruksahin/decree/decree 5 0%
#4,594 checksec 5 0%
#4,595 slp/virtiofs/virtiofsd 5 0%
#4,596 gtksourceview5 5 0%
#4,597 lambdatest/kane/kane-cli 5 0%
#4,598 zig@0.15 5 0%
#4,599 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-imagemagick --with-xwidgets 5 0%
#4,600 loganprosser/tap/milkterm 5 0%
#4,601 golift/mugs/secspy 5 0%
#4,602 z80oolong/eaw/neomutt@20260616 5 0%
#4,603 sidaf/pentest/ikeforce 5 0%
#4,604 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-dbus --with-imagemagick --with-mailutils --with-modern-icon-purple --with-mps --with-tree-sitter --with-xwidgets 5 0%
#4,605 asp-fzn 5 0%
#4,606 openbao 5 0%
#4,607 c4rb0nx1/tap/mog 5 0%
#4,608 akarin 5 0%
#4,609 tschoonj/tap/xraylib 5 0%
#4,610 timescam/tap/peaclock --HEAD 5 0%
#4,611 d12frosted/emacs-plus/emacs-plus@29 --with-native-comp --without-cocoa 5 0%
#4,612 anspar-org/elspais/elspais 5 0%
#4,613 capston2025/gaia/gaia 5 0%
#4,614 homebrew-ffmpeg/ffmpeg/ffmpeg-pro 5 0%
#4,615 skylighting 5 0%
#4,616 fraluc06/ffmpeg-svt-av1-essential/ffms2-custom 5 0%
#4,617 lizardbyte/homebrew/sunshine-beta --HEAD 5 0%
#4,618 dbx-cli 5 0%
#4,619 tonarino/innernet/innernet 5 0%
#4,620 gromgit/fuse/dislocker-mac --HEAD 5 0%
#4,621 carterlasalle/treecat/tracelayer 5 0%
#4,622 magikrun/magik/magik --HEAD 5 0%
#4,623 cmakelang 5 0%
#4,624 sidaf/pentest/sslscan-static 5 0%
#4,625 harmonybrew/core/gawk 5 0%
#4,626 harpertoken/tap/harper-ai 5 0%
#4,627 mkcert 5 0%
#4,628 pipdeptree 5 0%
#4,629 sgrastar24/tap/cbeacon 5 0%
#4,630 tombi 5 0%
#4,631 railwaycat/emacsmacport/emacs-mac@29 --with-unlimited-select 5 0%
#4,632 octoenergy/tap/ka-chow-cli 5 0%
#4,633 zimpl 5 0%
#4,634 rioriost/tap/age-mcp-server 5 0%
#4,635 ska-sa/tap/casacore --with-python 5 0%
#4,636 bl4cc4t/vsplugins/vsp-l-smash-works --HEAD 5 0%
#4,637 akku --HEAD 5 0%
#4,638 hack-different/jailbreak/yolo_dsc 5 0%
#4,639 jasonvassallo/tap/mlx-audiogen 5 0%
#4,640 hcloud 5 0%
#4,641 daviderestivo/fortune-mod/fortune-mod 5 0%
#4,642 vimpager --HEAD 5 0%
#4,643 0lini/qumulo-api/qumulo-api 5 0%
#4,644 postgresql-hll 5 0%
#4,645 ratex 5 0%
#4,646 cutiedeng/racket/racket@9 5 0%
#4,647 sigma-cli 5 0%
#4,648 strands-agents-sops 5 0%
#4,649 carrot2 5 0%
#4,650 naman1177/voxel/voxel 5 0%
#4,651 fthux/brew/notishift 5 0%
#4,652 aws-c-event-stream 5 0%
#4,653 dlutwuwei/qlib-cli/qlib-cli 5 0%
#4,654 cabin 5 0%
#4,655 hack-different/jailbreak/img4lib 5 0%
#4,656 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libzvbi --with-srt 5 0%
#4,657 backrest 5 0%
#4,658 terraformer 5 0%
#4,659 puleeno/openlitespeed/openlitespeed@1.9 5 0%
#4,660 eigen 5 0%
#4,661 customink/openssl-1.0/openssl@1.0 5 0%
#4,662 fzf-make 5 0%
#4,663 cartman-kai/thrift/thrift@0.10 5 0%
#4,664 mikutter 5 0%
#4,665 freeciv 5 0%
#4,666 double-conversion 5 0%
#4,667 tronbyt/tronbyt/tronbyt-server 5 0%
#4,668 avrdude --HEAD 5 0%
#4,669 mdbtools 5 0%
#4,670 qtlanguageserver 5 0%
#4,671 elixir 5 0%
#4,672 libadwaita --HEAD 5 0%
#4,673 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-imagemagick --with-native-comp --with-native-full-aot --with-pdumper --with-retro-icon-gnu-head --with-tree-sitter --with-xwidgets 5 0%
#4,674 swift-outdated 5 0%
#4,675 kelvinsilvadev/rserver/rserver 5 0%
#4,676 alan-turing-institute/hut23/meet 5 0%
#4,677 railwaycat/emacsmacport/emacs-mac@30exp --with-emacs-sexy-icon --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation 5 0%
#4,678 ottomatic-io/video/untrunc --HEAD 5 0%
#4,679 unship/unships/nelisp 5 0%
#4,680 cairomm@1.14 5 0%
#4,681 undercutf1 5 0%
#4,682 bloznelis/tap/kbt 5 0%
#4,683 homebrew-ffmpeg/ffmpeg/ffmpeg --with-svt-av1 5 0%
#4,684 astroterm 5 0%
#4,685 bramstein/webfonttools/sfntly 5 0%
#4,686 satoken/rnatools/centroidfold 5 0%
#4,687 postgresql@13 5 0%
#4,688 rustscan 5 0%
#4,689 zig@0.16 5 0%
#4,690 d12frosted/emacs-plus/emacs-plus@32 --with-debug --with-xwidgets 5 0%
#4,691 gmp-ecm 5 0%
#4,692 wontaekim89/tap/claude-hub 5 0%
#4,693 kompute 5 0%
#4,694 harmonybrew/core/gobject-introspection 5 0%
#4,695 dustinwilson/tap/cdparanoia 5 0%
#4,696 stuarthicks/tap/tstools 5 0%
#4,697 esptool 5 0%
#4,698 nest 5 0%
#4,699 enex2notion 5 0%
#4,700 watchexec 5 0%
#4,701 qkdxorjs1002/tap/taplctl 5 0%
#4,702 digital-chemistry-laboratory/multiwfn/multiwfn --HEAD --with-gui --with-openmp 5 0%
#4,703 cshlsiepellab/tools/vine 5 0%
#4,704 ualbertaaltlab/hfst/hfst 5 0%
#4,705 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 5 0%
#4,706 playwright-cli 5 0%
#4,707 summarize 5 0%
#4,708 aaronraimist/tap/gomuks 5 0%
#4,709 sidneys/homebrew/cdrkit 5 0%
#4,710 tomahawk-player/tomahawkqt5/jreen 5 0%
#4,711 vapor/tap/vapor-beta 5 0%
#4,712 d12frosted/emacs-plus/emacs-plus@31 --with-spacemacs-icon 5 0%
#4,713 weston 5 0%
#4,714 xctesthtmlreport/xchtmlreport/xchtmlreport 5 0%
#4,715 tcltls 5 0%
#4,716 make --HEAD 5 0%
#4,717 pgroll 5 0%
#4,718 semantic-reasoning/tap/wyrelog --HEAD 5 0%
#4,719 clasp-developers/clasp/clasp-cl --HEAD 5 0%
#4,720 cvsync 5 0%
#4,721 tlehman/tap/dotbar 5 0%
#4,722 opentelemetry-cpp 5 0%
#4,723 trud-rakva/repo/curl 5 0%
#4,724 martenframework/marten/marten 5 0%
#4,725 shivasurya/tap/pathfinder 5 0%
#4,726 henriquebastos/tap/jira-genie 5 0%
#4,727 timescaledb/tap/timescaledb --without-timescaledb-tools 5 0%
#4,728 cssr-tools/opm/type-lite 5 0%
#4,729 fastp 5 0%
#4,730 osrf/simulation/ignition-common3 5 0%
#4,731 dyx884877791/i386-jos-elf-gcc/gobject-introspection-jos 5 0%
#4,732 kubelogin 5 0%
#4,733 sdrangel 5 0%
#4,734 llvm@14 5 0%
#4,735 yo61/tap/jobhound 5 0%
#4,736 bartib 5 0%
#4,737 json-glib 5 0%
#4,738 shellshare 5 0%
#4,739 carlocab/personal/unrar 5 0%
#4,740 link-coder100788/whatdidido/whatdidido 5 0%
#4,741 sidaf/pentest/hostapd-wpe 5 0%
#4,742 sidaf/pentest/cuty_capt 5 0%
#4,743 zircote/git-adr/git-adr 5 0%
#4,744 doggo 5 0%
#4,745 andyshinn/mesh/meshtastic 5 0%
#4,746 aws-c-compression 5 0%
#4,747 g-maxime/mediaarea/ffmpeg-ma 5 0%
#4,748 cartman-kai/thrift/thrift@0.9.2 5 0%
#4,749 laszip 5 0%
#4,750 donngi/awsmfa/awsmfa 5 0%
#4,751 kew 5 0%
#4,752 tuist/tuist/tuist@3.23.1 5 0%
#4,753 headscale-cli 5 0%
#4,754 mostdistant/wail/wail 5 0%
#4,755 dotzero/tap/git-profile 5 0%
#4,756 gamedevcloudy/tools/flix-cli 5 0%
#4,757 daavid00/opm/opm-common 5 0%
#4,758 lensfun 5 0%
#4,759 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jpeg-xl --with-libgsm --with-libvidstab --with-openh264 --with-openjpeg --with-rav1e --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-xvid --with-zimg 5 0%
#4,760 min-lang 5 0%
#4,761 webtorrent-cli 5 0%
#4,762 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-librsvg --with-modern-icon --with-native-compilation --with-starter --with-unlimited-select --with-xwidgets 5 0%
#4,763 sttz/tap/install-unity 5 0%
#4,764 rawtoaces 5 0%
#4,765 gromgit/fuse/fossil-mac 5 0%
#4,766 davidjbianco/tools/richless 5 0%
#4,767 iitdbgroup/iitdbgroup/gprom 5 0%
#4,768 shadowsocks-libev 5 0%
#4,769 workerkit/tap/wk 5 0%
#4,770 officecli 5 0%
#4,771 tomtom-international/taps/cmake@3.14 5 0%
#4,772 brewsci/science/libbuddy 5 0%
#4,773 boost@1.85 5 0%
#4,774 mattheworiordan/tap/remi 5 0%
#4,775 srtp 5 0%
#4,776 multimarkdown --HEAD 5 0%
#4,777 samsadsam/kelam/kelam 5 0%
#4,778 d12frosted/emacs-plus/emacs-plus@30 --with-modern-black-dragon-icon 5 0%
#4,779 apache-arrow-glib 5 0%
#4,780 osmangoninahid/gitgossip/gitgossip 5 0%
#4,781 pandaxbacon/tap/github-copilot-chat-exporter 5 0%
#4,782 ashaltu/tap/qvm 5 0%
#4,783 xclip 5 0%
#4,784 42euge/geno/geno 5 0%
#4,785 brewsci/bio/fermi-lite 5 0%
#4,786 lla 5 0%
#4,787 drewmccormack/slop/slop 5 0%
#4,788 timharek/tap/migadu 5 0%
#4,789 shivammathur/extensions/newrelic@7.4 5 0%
#4,790 arb-project/arb/arb --HEAD --with-test 5 0%
#4,791 minio-mc 5 0%
#4,792 shivammathur/extensions/apcu@8.6 5 0%
#4,793 profanity --HEAD 5 0%
#4,794 brewsci/bio/cd-hit 5 0%
#4,795 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-native-comp 5 0%
#4,796 cmake-docs 5 0%
#4,797 audacious --HEAD 5 0%
#4,798 deus0ww/tap/mpv 5 0%
#4,799 amar1729/deluge-meta/deluge-meta 5 0%
#4,800 heihgm/bmatching/bmatching --HEAD 5 0%
#4,801 utkarshg1/pldatacli/pldatacli 5 0%
#4,802 openspec 5 0%
#4,803 spectrum-redteam/spectrum/spectrum-security 5 0%
#4,804 allegro 5 0%
#4,805 chapmanb/cbl/vep 5 0%
#4,806 federicopinan/tap/lazylofi 5 0%
#4,807 flow-cli 5 0%
#4,808 imagemagick@6 5 0%
#4,809 karlsruhemis/kamis/kamis 5 0%
#4,810 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --without-modules 5 0%
#4,811 newsraft 5 0%
#4,812 hhh2210/powervpn/powervpn 5 0%
#4,813 perl-xml-parser 5 0%
#4,814 tflint 5 0%
#4,815 mcp-inspector 5 0%
#4,816 sfc-gh-jiyan/macwhisper/macwhisper-mlx 5 0%
#4,817 d12frosted/emacs-plus/emacs-plus@29 --with-modern-pen-black-icon --with-native-comp 5 0%
#4,818 bennekrouf/aisrunner/aisrunner 5 0%
#4,819 rxseger/hackrf/rx_tools --HEAD 5 0%
#4,820 cppinsights 5 0%
#4,821 hdrhistogram_c 5 0%
#4,822 siriokds/dual-audio/dual-sidplayfp 5 0%
#4,823 amtterm 5 0%
#4,824 amiaopensource/amiaos/ffmpegdecklink --HEAD 5 0%
#4,825 kilork/dm-mono-nerd-font/dm-mono-nerd-font 5 0%
#4,826 vapoursynth-mvtools 5 0%
#4,827 tdsmith/ham/xastir 5 0%
#4,828 dlr-ts/sumo/sumo@1.9.0 5 0%
#4,829 jorji49/tap/streamtop 5 0%
#4,830 henriqueslab/formulas/folder2md4llms 5 0%
#4,831 lenivvenil/onenote-to-obsidian/onenote-to-obsidian 5 0%
#4,832 fv3rdugo/virt-manager/virt-viewer 5 0%
#4,833 d12frosted/emacs-plus/emacs-plus@30 --with-savchenkovaleriy-big-sur-3d-icon 5 0%
#4,834 cpierce/tap/l8nc 5 0%
#4,835 reposurgeon --HEAD 5 0%
#4,836 patelnav/ctrlspeak/ctrlspeak 5 0%
#4,837 ivoputzer/tg/tg 5 0%
#4,838 cee-jaym13/protobuf_25/protobuf-25 5 0%
#4,839 pratik1235/burnrate/burnrate 5 0%
#4,840 prasanthj/hnr/hnr 4 0%
#4,841 tdewolff/tap/minify 4 0%
#4,842 pymol --HEAD 4 0%
#4,843 minikube --HEAD 4 0%
#4,844 ome/alt/bioformats 4 0%
#4,845 mjpegtools 4 0%
#4,846 fdupes 4 0%
#4,847 pokryfka/dcode/dcode 4 0%
#4,848 calmcrow/formulae/winghexexplorer2 4 0%
#4,849 d12frosted/emacs-plus/emacs-plus@29 --with-ctags --with-debug --with-imagemagick --with-native-comp --with-x11 4 0%
#4,850 enpass-cli 4 0%
#4,851 petere/postgresql/postgresql@10 4 0%
#4,852 agammemnon/tap/bcvk 4 0%
#4,853 happn-app/public/locmapper 4 0%
#4,854 supertux 4 0%
#4,855 libxau 4 0%
#4,856 masukomi/tap/cleandiff 4 0%
#4,857 kabel/pecl/php-amqp 4 0%
#4,858 utiluti 4 0%
#4,859 meson --HEAD 4 0%
#4,860 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-spacemacs-icon --with-starter 4 0%
#4,861 spaceorc/clicker/clicker --HEAD 4 0%
#4,862 mmq/open-watcom/open-watcom-v2 4 0%
#4,863 conanoc/libindy/libindy 4 0%
#4,864 c4rl0s04/ascii-motion/ascii-motion 4 0%
#4,865 adrise/tubi/valet 4 0%
#4,866 jmhobbs/parrot/terminal-parrot 4 0%
#4,867 gonzo 4 0%
#4,868 dcm2niix 4 0%
#4,869 mickeyl/formulae/elmterm 4 0%
#4,870 digital-defiance/tap/bsh 4 0%
#4,871 fwupd 4 0%
#4,872 homebrew-ffmpeg/ffmpeg/ffmpeg --with-openssl 4 0%
#4,873 xnoto/opencode-agent-hub/opencode-agent-hub 4 0%
#4,874 mysql-to-sqlite3 4 0%
#4,875 xcinfo 4 0%
#4,876 freeciv --HEAD 4 0%
#4,877 gcc@9 4 0%
#4,878 danialfarid/tap/termdeck 4 0%
#4,879 chawan 4 0%
#4,880 cloc 4 0%
#4,881 d12frosted/emacs-plus/emacs-plus@29 --with-compress-install --with-imagemagick --with-native-comp --with-no-frame-refocus 4 0%
#4,882 romkatv/gitstatus/gitstatus 4 0%
#4,883 nirs/vmnet-helper/vmnet-helper 4 0%
#4,884 llmpm/llmpm/llmpm 4 0%
#4,885 life2you/tap/wetwin 4 0%
#4,886 kentaroh-toyoda/ask/ask 4 0%
#4,887 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 4 0%
#4,888 doronz88/tap/pymobiledevice3 4 0%
#4,889 dupclean 4 0%
#4,890 halide 4 0%
#4,891 oldcrow/macos13-fixes/qtbase 4 0%
#4,892 limengdu/seeed/seeed-zephyr 4 0%
#4,893 terrascan 4 0%
#4,894 peter-bread/tap/browserctl 4 0%
#4,895 freecad/freecad/nglib@6.2.2105 4 0%
#4,896 windusth/tap/gallery-tui --HEAD 4 0%
#4,897 fortio 4 0%
#4,898 delve 4 0%
#4,899 avchaykin/tap/screenshot-describer 4 0%
#4,900 amznsri/openvox/openvox 4 0%
#4,901 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-elrumo1-icon --with-imagemagick 4 0%
#4,902 dpogue/plasma-deps/string-theory 4 0%
#4,903 libevdev 4 0%
#4,904 tvcsantos/pi/pi 4 0%
#4,905 tetra 4 0%
#4,906 testkube 4 0%
#4,907 save3ds 4 0%
#4,908 osrf/simulation/chrono-engine 4 0%
#4,909 sinzin91/tap/search-sessions 4 0%
#4,910 simnalamburt/x/bunv 4 0%
#4,911 zathura 4 0%
#4,912 mcasper/formulae/git-clean 4 0%
#4,913 d12frosted/emacs-plus/emacs-plus@31 --with-gnu-head-icon --with-imagemagick 4 0%
#4,914 saiden-dev/tap/psn --HEAD 4 0%
#4,915 nzbget --HEAD 4 0%
#4,916 hiero-ledger/tools/solo 4 0%
#4,917 amlel-el-mahrouss/mips64/mips-linux-gnu-binutils 4 0%
#4,918 codemeister64/swiftypoeditor/swiftypoeditor 4 0%
#4,919 djetelina/tap/cheznav 4 0%
#4,920 deno --HEAD 4 0%
#4,921 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libbluray --with-libflite --with-libplacebo --with-librsvg --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-svt-av1 --with-tensorflow --with-tesseract --with-webp --with-whisper-cpp --with-xvid 4 0%
#4,922 varnish 4 0%
#4,923 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 4 0%
#4,924 akeru-inc/tap/xcnotary 4 0%
#4,925 yordilorenzo/tap/hbkit 4 0%
#4,926 kozyrap/libimobiledevice/libimobiledevice --HEAD 4 0%
#4,927 lilv 4 0%
#4,928 sidneys/homebrew/mpv-iina 4 0%
#4,929 harmonybrew/core/dnote 4 0%
#4,930 ehco 4 0%
#4,931 swiftgen --HEAD 4 0%
#4,932 sqlite-analyzer 4 0%
#4,933 shivammathur/extensions/pdo_firebird@8.6 4 0%
#4,934 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libvidstab --with-openal-soft --with-openh264 --with-openssl --with-rav1e --with-rubberband --with-srt 4 0%
#4,935 atmos 4 0%
#4,936 bobmatnyc/tools/ai-commander 4 0%
#4,937 meli 4 0%
#4,938 tecolicom/tap/app-mdee 4 0%
#4,939 newrelic-infra-agent 4 0%
#4,940 r-rig --HEAD 4 0%
#4,941 abelo9996/tap/rerun-bench 4 0%
#4,942 libxpm 4 0%
#4,943 modal 4 0%
#4,944 sidaf/pentest/dirb 4 0%
#4,945 mohitagw15856/tap/offerprinter 4 0%
#4,946 shivammathur/extensions/interbase@8.4 4 0%
#4,947 harmonybrew/core/azure-core-cpp 4 0%
#4,948 linux-headers@6.8 4 0%
#4,949 mlaify/tap/attackmap 4 0%
#4,950 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libxml2 4 0%
#4,951 shivammathur/extensions/couchbase@8.2 4 0%
#4,952 cspell 4 0%
#4,953 tock 4 0%
#4,954 wavemon 4 0%
#4,955 lifepillar/appleii/lisaem 4 0%
#4,956 hxmbl/tap/separator 4 0%
#4,957 rvanbaalen/agent-vision/agent-vision 4 0%
#4,958 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-imagemagick --with-mailutils --with-xwidgets 4 0%
#4,959 ilotoki0804/mrg/mrg 4 0%
#4,960 mosra/magnum/corrade 4 0%
#4,961 iraf-community/tap/x11iraf 4 0%
#4,962 d12frosted/emacs-plus/emacs-plus@30 --with-nobu417-big-sur-icon 4 0%
#4,963 quocdung21/tap/git-ai 4 0%
#4,964 nlohmann-json --HEAD 4 0%
#4,965 greenways-ai/tap/hoplite 4 0%
#4,966 w5s/tap/laptop --HEAD 4 0%
#4,967 newt 4 0%
#4,968 donngi/pipeline-lens/pipeline-lens 4 0%
#4,969 ublue-os/experimental-tap/compass 4 0%
#4,970 grip 4 0%
#4,971 brewsci/bio/ivar 4 0%
#4,972 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 4 0%
#4,973 sng 4 0%
#4,974 adamspofford-dfinity/icp-cli/icp-cli 4 0%
#4,975 crystalline 4 0%
#4,976 libwmf 4 0%
#4,977 nicolaric/tap/minicode 4 0%
#4,978 harmonybrew/core/aws-c-common 4 0%
#4,979 tesserix/stockpilot/stockpilot 4 0%
#4,980 claude-code-templates 4 0%
#4,981 dhall 4 0%
#4,982 ninvaders 4 0%
#4,983 sailgagag/tap/sailbug 4 0%
#4,984 tecolicom/tap/sl-classic 4 0%
#4,985 link-coder100788/ruby-sdl2/ruby-sdl2 4 0%
#4,986 dandylyons/tap/treedocs 4 0%
#4,987 pdftk-java 4 0%
#4,988 sbom-tool/tap/sbom-tools 4 0%
#4,989 opentofu --HEAD 4 0%
#4,990 rntgspr/tap/claude-statusline-stickers 4 0%
#4,991 mariadb@10.5 4 0%
#4,992 cleishm/neo4j/libneo4j-client 4 0%
#4,993 charitra-prem/pcci/pcci 4 0%
#4,994 repeater 4 0%
#4,995 v8@12 4 0%
#4,996 levitk/tap/n-m3u8dl-re 4 0%
#4,997 audacious 4 0%
#4,998 slepc-complex 4 0%
#4,999 dune 4 0%
#5,000 k-leumas/tap/queque 4 0%
#5,001 psc-package 4 0%
#5,002 blogabe/xtg/xt 4 0%
#5,003 file-formula 4 0%
#5,004 hitpointx/wrex/wrex 4 0%
#5,005 pinboard-notes-backup 4 0%
#5,006 nvi 4 0%
#5,007 freeradius-server 4 0%
#5,008 niluje/kindletool/nettle-git --HEAD 4 0%
#5,009 jyjyjcr/materiapps/quantum-espresso 4 0%
#5,010 aadarwal/tap/helium-sync 4 0%
#5,011 gromgit/dev/uxn 4 0%
#5,012 brianm/tools/bdsh 4 0%
#5,013 macmade/tap/xrun --HEAD 4 0%
#5,014 jsoncpp 4 0%
#5,015 dhall-toml 4 0%
#5,016 arferreira/tap/loshell 4 0%
#5,017 cornelis 4 0%
#5,018 sunjmjmx/termworkspace/termworkspace 4 0%
#5,019 rofi 4 0%
#5,020 michaeldhopkins/tap/safe-chains 4 0%
#5,021 punt-labs/tap/quarry-menubar --HEAD 4 0%
#5,022 hare 4 0%
#5,023 d12frosted/emacs-plus/emacs-plus@30 --with-modern-black-gnu-head-icon 4 0%
#5,024 swiftplantuml 4 0%
#5,025 redhillsmediafl/caix/caix 4 0%
#5,026 danieljustus/tap/symingest 4 0%
#5,027 iso-codes 4 0%
#5,028 deaugarcon/tap/trug 4 0%
#5,029 phoenixshen/gtkwave/gtkwave --HEAD 4 0%
#5,030 go-camo 4 0%
#5,031 d12frosted/emacs-plus/emacs-plus@29 --with-no-frame-refocus --with-xwidgets 4 0%
#5,032 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-imagemagick --with-native-compilation --with-xwidgets 4 0%
#5,033 pagmo 4 0%
#5,034 fzy --HEAD 4 0%
#5,035 llvm-mingw-w64 4 0%
#5,036 engali94/formulae/xmljson 4 0%
#5,037 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-librsvg --with-native-compilation --with-spacemacs-icon --with-starter --with-xwidgets 4 0%
#5,038 alhadis/troff/neatroff 4 0%
#5,039 ldapvi 4 0%
#5,040 burakayener/lystn/lystn 4 0%
#5,041 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-imagemagick --with-librsvg --with-native-comp --with-natural-title-bar --with-starter --with-unlimited-select --with-xwidgets 4 0%
#5,042 yohey/opencae/openmodelica@1.26 4 0%
#5,043 cyclone-scheme/cyclone/cyclone-bootstrap 4 0%
#5,044 ledit 4 0%
#5,045 gowall 4 0%
#5,046 wifitui 4 0%
#5,047 tbls 4 0%
#5,048 radar 4 0%
#5,049 ashabbir/savant/savant-abilities 4 0%
#5,050 libosinfo 4 0%
#5,051 rmtrash 4 0%
#5,052 aaratha/emacs-plus/emacs-plus@29 --with-modern-alecive-flatwoken-icon --with-native-comp --with-xwidgets 4 0%
#5,053 sdl3_ttf 4 0%
#5,054 openresty/nginx/openresty 4 0%
#5,055 cargo-insta 4 0%
#5,056 remake 4 0%
#5,057 exo 4 0%
#5,058 designbynumbers/cantarellalab/libtsnnls 4 0%
#5,059 dvr-scan 4 0%
#5,060 huxuanming/cliproxyapi/cliproxyapi 4 0%
#5,061 saurabhjainitbhu/krama/krama 4 0%
#5,062 footswitch --HEAD 4 0%
#5,063 kidanger/vpv/vpv 4 0%
#5,064 dskditto 4 0%
#5,065 vatsaljagani/tap/disktree 4 0%
#5,066 rayinuk13/browsr/browsr 4 0%
#5,067 akriaueno/tap/why 4 0%
#5,068 bde 4 0%
#5,069 cjtaylor10/ccdash-tap/ccdash 4 0%
#5,070 acture/ac/reviewloop 4 0%
#5,071 mr-neutr0n/tap/bounty-harness 4 0%
#5,072 defai-digital/ax-code/ax-code 4 0%
#5,073 rexx-org/rexx-org/the-conw-oorexx 4 0%
#5,074 dlr-ts/sumo/sumo@1.9.1 4 0%
#5,075 brewsci/bio/iqtree3 4 0%
#5,076 opentimestamps-client 4 0%
#5,077 pothosware/pothos/soapyairspyhf 4 0%
#5,078 ddclient 4 0%
#5,079 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-ctags --with-debug --with-imagemagick --with-xwidgets 4 0%
#5,080 xt9y/msl/msl 4 0%
#5,081 fancy-cat 4 0%
#5,082 keepassc 4 0%
#5,083 pkryger/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-arc --with-optimization-flags --with-transparent-titlebar 4 0%
#5,084 turlockmike/murl/murl 4 0%
#5,085 gallery-dl --HEAD 4 0%
#5,086 scaryrawr/formulae/omlx --with-grammar 4 0%
#5,087 hardworker/usbfluxd/usbfluxd 4 0%
#5,088 potrace 4 0%
#5,089 izantech/tap/yup 4 0%
#5,090 sidaf/pentest/jex_boss 4 0%
#5,091 nvk/tap/agentnoise 4 0%
#5,092 carterlasalle/tap/seed 4 0%
#5,093 backlog-md 4 0%
#5,094 mxkolb30/deej/deej 4 0%
#5,095 charromax/lid-sound/lid-sound 4 0%
#5,096 icloudpd 4 0%
#5,097 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libgsm --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libxml2 --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-webp --with-whisper-cpp 4 0%
#5,098 tmuxai 4 0%
#5,099 aide-qc/deploy/llvm-csp 4 0%
#5,100 akinus21/tap/akclip 4 0%
#5,101 idomizrachi-bringg/dev-tools/regen 4 0%
#5,102 libgedit-gtksourceview 4 0%
#5,103 rsgain 4 0%
#5,104 archprime-official/lovarch/lovarch-cli 4 0%
#5,105 brewsci/bio/virulign 4 0%
#5,106 zydo/tap/alle 4 0%
#5,107 openresty/brew/openresty-openssl 4 0%
#5,108 swiftxcode/swiftxcode/swift-xcode 4 0%
#5,109 brewsci/bio/bwa-mem2 4 0%
#5,110 s-nail 4 0%
#5,111 rusintez/tap/brain 4 0%
#5,112 schloegl/biosig/stimfit 4 0%
#5,113 simonteague6/aloud-tts/aloud-tts 4 0%
#5,114 openrtm/openrtm2/openrtm2-py310 4 0%
#5,115 vim-classic 4 0%
#5,116 neuroship/tap/inframate 4 0%
#5,117 7wmr/tools/godaddy-cli 4 0%
#5,118 libcotp 4 0%
#5,119 tgtakaoka/m6809/gcc-m6809 4 0%
#5,120 dojofive/dojofive/protobuf@3.19 4 0%
#5,121 direwolf 4 0%
#5,122 pgarfagnoli/buddy/buddy 4 0%
#5,123 ublue-os/tap/linux-mcp-server 4 0%
#5,124 dive --HEAD 4 0%
#5,125 macchanger 4 0%
#5,126 observerward 4 0%
#5,127 libinput 4 0%
#5,128 grizzly 4 0%
#5,129 grafana-alloy 4 0%
#5,130 getcoldfire/coldfire/coldfire-mlx-server 4 0%
#5,131 sndio 4 0%
#5,132 5ouma/tap/gh-poi 4 0%
#5,133 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 4 0%
#5,134 brewsci/bio/minia 4 0%
#5,135 danielcardonarojas/codemark/codemark 4 0%
#5,136 lsr 4 0%
#5,137 mypurecloud/gc/gc 4 0%
#5,138 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-dbus --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-natural-title-bar --with-starter 4 0%
#5,139 dateutils 4 0%
#5,140 g-maxime/mediaarea/bwfmetaedit-gui 4 0%
#5,141 cdavis-code/blueteam/blueteam-autopilot 4 0%
#5,142 h4x0r/nameback/nameback 4 0%
#5,143 muon 4 0%
#5,144 d12frosted/emacs-plus/emacs-plus@29 --with-native-comp --with-no-frame-refocus --with-xwidgets 4 0%
#5,145 willyv3/tap/vinw 4 0%
#5,146 kabel/pecl/php@8.3-igbinary 4 0%
#5,147 carl-storm 4 0%
#5,148 eso/pipelines/esopipe-eris-recipes 4 0%
#5,149 brewsci/bio/portcullis 4 0%
#5,150 spot 4 0%
#5,151 elmercsc/elmerfem/elmer --HEAD 4 0%
#5,152 oclgrind 4 0%
#5,153 gmerlino/udftools/udftools --HEAD 4 0%
#5,154 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 4 0%
#5,155 iron-ham/swift-commit-gen/scg 4 0%
#5,156 brewsci/science/cufflinks 4 0%
#5,157 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-debug --with-imagemagick --with-mailutils 4 0%
#5,158 kenjimyzk/eblook/eblook 4 0%
#5,159 supaicy/tap/bicmac 4 0%
#5,160 lispnik/tecgraf/tecgraf-cd 4 0%
#5,161 mikeb26/tap/spotsh 4 0%
#5,162 unisis-unil/tools/bastion 4 0%
#5,163 biome 4 0%
#5,164 brewsci/bio/prank 4 0%
#5,165 hof 4 0%
#5,166 ipfs 4 0%
#5,167 taoup 4 0%
#5,168 d2 --HEAD 4 0%
#5,169 cln 4 0%
#5,170 saiso/tap/claude-code-notifier 4 0%
#5,171 stripe/purl/purl 4 0%
#5,172 pdf2svg 4 0%
#5,173 dep-scan 4 0%
#5,174 harmonybrew/core/zellij 4 0%
#5,175 odin 4 0%
#5,176 florinm03/zathura/zathura --with-no-titlebar 4 0%
#5,177 tfcollins/formulae/libad9361-iio --HEAD 4 0%
#5,178 mikedan37/blazedb/blazerepl 4 0%
#5,179 amber 4 0%
#5,180 akatmks/vapoursynth-plugins/vapoursynth-lsmas --HEAD 4 0%
#5,181 opendht 4 0%
#5,182 ottomatic-io/video/libmxfpp 4 0%
#5,183 etherops/ephew/ephew 4 0%
#5,184 dosbox-x-revertcmos 4 0%
#5,185 krane 4 0%
#5,186 keith/formulae/fix-macosx-internal-sdk 4 0%
#5,187 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-doom3-icon --with-native-comp --with-xwidgets 4 0%
#5,188 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-icon --with-native-comp 4 0%
#5,189 trud-rakva/repo/c-kermit 4 0%
#5,190 gpac --HEAD 4 0%
#5,191 mesheryctl 4 0%
#5,192 lalomorales22/ollama-coder/ollama-coder 4 0%
#5,193 fangtianwd/tap/mdns-reflector-go 4 0%
#5,194 notunrandom/cardano/consensus-db-tools 4 0%
#5,195 d12frosted/emacs-plus/emacs-plus@31 --without-cocoa 4 0%
#5,196 verge-io/tap/vrg 4 0%
#5,197 openkj/openkj/openkj 4 0%
#5,198 alexmachina/spotify-downloader/spotify-downloader 4 0%
#5,199 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-spacemacs-icon --with-xwidgets 4 0%
#5,200 neon 4 0%
#5,201 achernev/tap/docker-mac-net-connect 4 0%
#5,202 tenacity 4 0%
#5,203 theapplegates/kleopatra6mac/kf6-ktextaddons 4 0%
#5,204 d12frosted/emacs-plus/emacs-plus@30 --with-modern-black-variant-icon 4 0%
#5,205 roberthawdon/dfshow/dfshow 4 0%
#5,206 niuton/tap/disk-analyst-tui 4 0%
#5,207 zeroclaw 4 0%
#5,208 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-mailutils --with-xwidgets 4 0%
#5,209 github-mcp-server 4 0%
#5,210 diskonaut 4 0%
#5,211 harmonybrew/core/uv 4 0%
#5,212 i686-elf-binutils 4 0%
#5,213 cyakimov/tap/metron 4 0%
#5,214 homebrew-zathura/zathura/girara 4 0%
#5,215 m9h/neuro/levmar 4 0%
#5,216 git-bug 4 0%
#5,217 charm-tools 4 0%
#5,218 shivammathur/extensions/interbase@5.6 4 0%
#5,219 libi/tap/ko-browser 4 0%
#5,220 efl 4 0%
#5,221 philpennock/protocols/sieve-connect --with-gssapi 4 0%
#5,222 druide67/tap/asiai 4 0%
#5,223 mzxzd/janet/janet-all 4 0%
#5,224 hhatto/pgmagick/pgmagick 4 0%
#5,225 davidchall/hep/fastjet 4 0%
#5,226 theapplegates/kleopatra6mac/kf6-karchive 4 0%
#5,227 rfritz/misc/tenacity 4 0%
#5,228 tksohishi/tap/tgcli 4 0%
#5,229 shivammathur/extensions/xlswriter@8.6 4 0%
#5,230 takeshixx/tap/deen 4 0%
#5,231 graphqlite 4 0%
#5,232 deadfinder 4 0%
#5,233 osrf/simulation/ignition-msgs8 4 0%
#5,234 py-spy 4 0%
#5,235 pgpdump 4 0%
#5,236 diskwatch 4 0%
#5,237 cuber/openssl/openssl@1.0 4 0%
#5,238 naba-nyan/formulae/zathura 4 0%
#5,239 tyhal/tap/gotraceui --HEAD 4 0%
#5,240 filosottile/musl-cross/musl-cross --without-aarch64 --without-arm-hf 4 0%
#5,241 pkryger/emacsmacport-exp/emacs-mac-exp@31 --HEAD --with-mac-metal --with-xwidgets 4 0%
#5,242 fulsomenko/tap/kanban 4 0%
#5,243 dnscrypt-proxy 4 0%
#5,244 mkvtoolnix --HEAD 4 0%
#5,245 libjaylink 4 0%
#5,246 sbom-tool 4 0%
#5,247 lux 4 0%
#5,248 frostymur/aerofi/aeroflow 4 0%
#5,249 idomizrachi/regen/regen 4 0%
#5,250 timvw/tap/qv 4 0%
#5,251 pkryger/emacsmacport-exp/emacs-mac-exp@31 --HEAD 4 0%
#5,252 awscli@1 4 0%
#5,253 boldandbrad/tap/meeple-cli 4 0%
#5,254 jimeh/emacs-builds/emacs-from-source --HEAD 4 0%
#5,255 frosit/mysql/mysql@8.3 4 0%
#5,256 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-imagemagick --with-modern-sexy-v2-icon 4 0%
#5,257 lyzlov-twelve/tap/claude-sessions-tui 4 0%
#5,258 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 4 0%
#5,259 jabba 4 0%
#5,260 libffi --HEAD 4 0%
#5,261 joker 4 0%
#5,262 sidaf/pentest/whatweb 4 0%
#5,263 joyce 4 0%
#5,264 moesnow/tools/bing-wallpaper-macos 4 0%
#5,265 pmix --HEAD 4 0%
#5,266 roboticslibrary/rl/rl --HEAD 4 0%
#5,267 makeawishfoundation/swiftymocky/swiftymocky 4 0%
#5,268 memray 4 0%
#5,269 lib3mf 4 0%
#5,270 hlrs-vis/tap/covise --HEAD 4 0%
#5,271 plaid-ai/nuv-agent-homebrew/nuv-agent 4 0%
#5,272 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-rav1e 4 0%
#5,273 everpeace/ssh-agent-filter/ssh-agent-filter 4 0%
#5,274 osrf/simulation/bullet@2.87 4 0%
#5,275 dbochman/echonest/echonest-sync 4 0%
#5,276 wadosmp4/afk-claude/afk-claude-companion 4 0%
#5,277 kardolus/chatgpt-cli/chatgpt-cli 4 0%
#5,278 neovim-qt 4 0%
#5,279 saschaholesch/ntsc/xcclean 4 0%
#5,280 davix 4 0%
#5,281 brewsci/bio/hssp 4 0%
#5,282 rpm --HEAD 4 0%
#5,283 happyrip/negative-auto-crop/negative-auto-crop 4 0%
#5,284 lotharieslayer/apple/game-porting-toolkit 4 0%
#5,285 alvnukov/tap/happ 4 0%
#5,286 cassiocassio/bristlenose/bristlenose 4 0%
#5,287 m9h/neuro/febiostudio 4 0%
#5,288 dbhash 4 0%
#5,289 linux-noah/noah/noah 4 0%
#5,290 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-imagemagick --with-memeplex-wide-icon --with-xwidgets 4 0%
#5,291 cling 4 0%
#5,292 portaudio 4 0%
#5,293 kong/kongctl/kongctl 4 0%
#5,294 secondcoolestguy/bird/bird 4 0%
#5,295 ayushanuj/tap/resturant-ai 4 0%
#5,296 jarun/imgp/imgp 4 0%
#5,297 obscura 4 0%
#5,298 mattt/tap/olleh 4 0%
#5,299 goat 4 0%
#5,300 roarkhq/tap/roark 4 0%
#5,301 qscintilla2 4 0%
#5,302 libetpan --HEAD 4 0%
#5,303 mathobsession/tap/vicinus-ai 4 0%
#5,304 olane-labs/tap/copass 4 0%
#5,305 mrpeski/openwebui/openwebui 4 0%
#5,306 grego360/tap/daily-dashboard 4 0%
#5,307 octave-app/octave-app/octave@10.2.0 4 0%
#5,308 privatevictories-main/tap/claude-auto-continue 4 0%
#5,309 cartavis/tap/carta-casacore 4 0%
#5,310 nspr 4 0%
#5,311 ppsspp --HEAD 4 0%
#5,312 gol 4 0%
#5,313 giantravens/tap/mdbrowse 4 0%
#5,314 linus-shyu/tap/starfetch 4 0%
#5,315 davidnussio/tap/envsec 4 0%
#5,316 libmonome 4 0%
#5,317 bokic/textparser/textparser 4 0%
#5,318 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark --with-smartcard 4 0%
#5,319 osrf/simulation/gz-sim9 4 0%
#5,320 sidaf/pentest/mitmf 4 0%
#5,321 wvanlint/twf/twf --HEAD 4 0%
#5,322 brewsci/bio/solexaqa 4 0%
#5,323 denji/nginx/nginx-full --with-gzip-static --with-realip 4 0%
#5,324 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --with-starter 4 0%
#5,325 jdx/tap/aube 4 0%
#5,326 libupnp 4 0%
#5,327 tox/tox/toxic --HEAD 4 0%
#5,328 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-native-comp --with-xwidgets 4 0%
#5,329 jstkdng/programs/ueberzugpp --HEAD 4 0%
#5,330 aws-nuke 4 0%
#5,331 mrsamseen/diskman/diskman 4 0%
#5,332 adaptivecpp 4 0%
#5,333 alpheuscef/tap/alph 4 0%
#5,334 zahintapadar/tap/adb-app-manager 4 0%
#5,335 rattler-index 4 0%
#5,336 harmonybrew/core/rustup 4 0%
#5,337 elixir-ls 4 0%
#5,338 ktemkin/oss-fpga/nextpnr-ecp5 --HEAD 4 0%
#5,339 libglvnd 4 0%
#5,340 luthiraa/ascii-map/ascii-map 4 0%
#5,341 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libaribb24 --with-libaribcaption --with-libvidstab --with-webp 4 0%
#5,342 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jack --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-xvid --with-zimg 4 0%
#5,343 srikur/tap/docc2pdf 4 0%
#5,344 libiio 4 0%
#5,345 lgarron/lgarron/eject-all-cards --HEAD 4 0%
#5,346 ariadne-cps/tap/ariadne 4 0%
#5,347 gnumeric 4 0%
#5,348 shawnz/printing/min12xxw 4 0%
#5,349 pinentry 4 0%
#5,350 fredyshox/tools/screenframer 4 0%
#5,351 gajim 4 0%
#5,352 tobischelling/tap/aicrawler 4 0%
#5,353 treemd 4 0%
#5,354 whosthere 4 0%
#5,355 librdkafka@2.0.2 4 0%
#5,356 broot 4 0%
#5,357 harmonybrew/core/lsof 4 0%
#5,358 tmuxinator --HEAD 4 0%
#5,359 travis 4 0%
#5,360 souffle-lang/souffle/souffle 4 0%
#5,361 gerlero/openfoam/multicollections 4 0%
#5,362 david0/audio/calf --with-cairo --with-gtk+ 4 0%
#5,363 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-no-title-bars --without-modules 4 0%
#5,364 qthttpserver 4 0%
#5,365 brewsci/bio/d4tools 4 0%
#5,366 zdk/tools/lowfat 4 0%
#5,367 shivammathur/php/php@8.3.13 4 0%
#5,368 osrf/simulation/dartsim@6.10.0 4 0%
#5,369 jakeasaurus/tap/lazystatus 4 0%
#5,370 brewsci/bio/roary 4 0%
#5,371 luxfi/tap/lux-lattice 4 0%
#5,372 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-dbus 4 0%
#5,373 brewsci/bio/phlawd 4 0%
#5,374 kahip/kahip/freight 4 0%
#5,375 gauche 4 0%
#5,376 litellm 4 0%
#5,377 percona-toolkit 4 0%
#5,378 jpeg 4 0%
#5,379 d3mlabs/d3mlabs/wwise-cli 4 0%
#5,380 guracc/tap/simple-icons 4 0%
#5,381 mender-cli 4 0%
#5,382 rfc1459/personal/x3270-x11 4 0%
#5,383 jpdck/openloco/openloco 4 0%
#5,384 gromgit/new-life/frobtads 4 0%
#5,385 cargo-outdated 4 0%
#5,386 openzl 4 0%
#5,387 kns 4 0%
#5,388 lgarron/lgarron/thermal-pressure --HEAD 4 0%
#5,389 lldpd 4 0%
#5,390 regent-vcs/tap/regent 4 0%
#5,391 kelp/tap/vibeutils 4 0%
#5,392 vectorscan 4 0%
#5,393 arm-none-eabi-gdb 4 0%
#5,394 tombromley1989/brewmeister/brewmeister 4 0%
#5,395 libiio --HEAD 4 0%
#5,396 mirrord 4 0%
#5,397 joncode/tap/jumpcall 4 0%
#5,398 herrkaefer/micpipe/micpipe 4 0%
#5,399 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --with-native-compilation --with-starter 4 0%
#5,400 bogdan-calapod/tap/asryx 4 0%
#5,401 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-native-comp --with-no-frame-refocus 4 0%
#5,402 u-boot-tools 4 0%
#5,403 owfs 4 0%
#5,404 d12frosted/emacs-plus/emacs-plus@29 --with-ctags --with-imagemagick --with-native-comp 4 0%
#5,405 d12frosted/emacs-plus/emacs-plus@31 --with-cacodemon-icon --with-imagemagick --with-xwidgets 4 0%
#5,406 brewsci/bio/ska 4 0%
#5,407 twarc 4 0%
#5,408 oigarash/circuit-cli/circuit-cli 4 0%
#5,409 xiufengsun/tokentracker/tokentracker 4 0%
#5,410 lesspipe 4 0%
#5,411 virglrenderer 4 0%
#5,412 harmonybrew/core/ruby 4 0%
#5,413 fs-uae --HEAD 4 0%
#5,414 libtcod 4 0%
#5,415 d12frosted/emacs-plus/emacs-plus@30 --with-modern-pen-black-icon 4 0%
#5,416 osgeo/osgeo4mac/osgeo-hdf4 4 0%
#5,417 my-qemu 4 0%
#5,418 osgeo/osgeo4mac/osgeo-liblas 4 0%
#5,419 dolphie 4 0%
#5,420 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-memeplex-slim-icon 4 0%
#5,421 cjavdev/spotted-cli/spotted-cli 4 0%
#5,422 ty 4 0%
#5,423 d12frosted/emacs-plus/emacs-plus@29 --with-modern-black-dragon-icon --with-native-comp 4 0%
#5,424 harmonybrew/core/pybind11 4 0%
#5,425 sqlite-utils 4 0%
#5,426 jwulff/tap/steno 4 0%
#5,427 tree-sitter@0.25 4 0%
#5,428 snapsynapse/tap/substack2md 4 0%
#5,429 remind 4 0%
#5,430 moodle-dl 4 0%
#5,431 qbittorrent-cli 4 0%
#5,432 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-rav1e --with-svt-av1 4 0%
#5,433 mflowcode/mfc/mfc 4 0%
#5,434 anoshor/typefaster/typefaster 4 0%
#5,435 poiurewq/tools/mewsify 4 0%
#5,436 ogilthorp3/sanctum/sanctum-cli 4 0%
#5,437 iodigital-com/opensearch-maintenance/opensearch@2 4 0%
#5,438 akamai/mfa/akr 4 0%
#5,439 harmonybrew/core/openbao 4 0%
#5,440 ayo-ooo/tap/ayo 4 0%
#5,441 mohammedimaad/coldstar/coldstar 4 0%
#5,442 stunnel 4 0%
#5,443 mcp-grafana 4 0%
#5,444 vulkan-extensionlayer 4 0%
#5,445 pmamico/keg/matrix-cam 4 0%
#5,446 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 4 0%
#5,447 brewsci/bio/hh-suite 4 0%
#5,448 josharsh/claude-utils/claude-utils 4 0%
#5,449 hexhog 4 0%
#5,450 fenio/tap/zod 4 0%
#5,451 claudiiii/tap/mumble 4 0%
#5,452 daviderestivo/emacs-head/emacs-head@31 4 0%
#5,453 fraluc06/ffmpeg-svt-av1-essential/svt-av1-essential-lib 4 0%
#5,454 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-natural-title-bar --with-starter 4 0%
#5,455 nusretmemic/macmaint/macmaint 4 0%
#5,456 iman1704/tap/terminal-notifier 4 0%
#5,457 yukaii/tap/bontree --HEAD 4 0%
#5,458 abcdofficialzw/netmon/netmon 4 0%
#5,459 aviadshiber/tap/langfuse-cli 4 0%
#5,460 ayansengupta17/gemini-cli/gemini-cli 4 0%
#5,461 harmonybrew/core/rathole 4 0%
#5,462 lft 4 0%
#5,463 czmq 4 0%
#5,464 libpcl 4 0%
#5,465 sngrep 4 0%
#5,466 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 4 0%
#5,467 uriparser 4 0%
#5,468 takesako/sigrok/pulseview --HEAD 4 0%
#5,469 inadyn 4 0%
#5,470 automagik-genie 4 0%
#5,471 cxwx/cxbrew/mathplot --HEAD 4 0%
#5,472 package-version-server 4 0%
#5,473 oxen 4 0%
#5,474 abdullah4ai/tap/appledev 4 0%
#5,475 icestorm --HEAD 4 0%
#5,476 panproto/tap/schema 4 0%
#5,477 damenly/virt-manager/virt-viewer 4 0%
#5,478 netatalk 4 0%
#5,479 py7zr 4 0%
#5,480 lxc 4 0%
#5,481 g-maxime/mediaarea/ffmpeg-ma --HEAD 4 0%
#5,482 jumpyvi/morebrew/rofi-calc 4 0%
#5,483 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libvmaf --with-libxml2 --with-openssl@3 --with-webp 4 0%
#5,484 geo-mena/pixii/pixii 4 0%
#5,485 overturemaps 4 0%
#5,486 lulzx/tap/cumetal 4 0%
#5,487 b2-tools 4 0%
#5,488 brewsci/num/brewsci-r 4 0%
#5,489 nb-cli 4 0%
#5,490 brewsci/bio/delly 4 0%
#5,491 granian 4 0%
#5,492 arm-linux-gnueabihf-binutils 4 0%
#5,493 brewsci/bio/salmid 4 0%
#5,494 slp/krun/libkrun --HEAD 4 0%
#5,495 cfitsio 4 0%
#5,496 careerplug/opensearch-maintenance/opensearch@2 4 0%
#5,497 dust 4 0%
#5,498 brendan-nasa/trick/trick 4 0%
#5,499 dilumaluthge/tap/pijul 4 0%
#5,500 luahbtex 4 0%
#5,501 nvk/tap/llm-health 4 0%
#5,502 coin-or-tools/coinor/symphony 4 0%
#5,503 mtg/essentia/essentia --HEAD --with-tensorflow --without-python 4 0%
#5,504 shen-language/shen/shen-scheme 4 0%
#5,505 lispnik/tecgraf/tecgraf-iup 4 0%
#5,506 zig@0.14 4 0%
#5,507 wyne/tap/fasder 4 0%
#5,508 k3min/n64-dev/mips-linux-gnu-binutils 4 0%
#5,509 yncyrydybyl/matrix-commander/matrix-commander 4 0%
#5,510 antoniorodr/memo/memo --HEAD 4 0%
#5,511 dnstwist 4 0%
#5,512 rdfind 4 0%
#5,513 leopher --HEAD 4 0%
#5,514 plexideas/tap/rei-graph 4 0%
#5,515 the_silver_searcher 4 0%
#5,516 llnl-units 4 0%
#5,517 brewsci/bio/nextgenmap 4 0%
#5,518 ftxui 4 0%
#5,519 nijaru/tap/sy --HEAD 4 0%
#5,520 ssldump 4 0%
#5,521 d12frosted/emacs-plus/emacs-plus@31 --with-dbus 4 0%
#5,522 binarcode/aidocs/aidocs 4 0%
#5,523 kpcli 4 0%
#5,524 philpennock/protocols/sieve-connect --with-brew-perl --without-readline 4 0%
#5,525 harmonybrew/core/glib 4 0%
#5,526 seqwish 4 0%
#5,527 pom11/tap/radio 4 0%
#5,528 shivammathur/extensions/interbase@8.5 4 0%
#5,529 soumen888/ragchat/ragchat 4 0%
#5,530 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-imagemagick --with-liquid-glass --with-native-comp --with-xwidgets 4 0%
#5,531 htrb/tap/ngraph-gtk --HEAD 4 0%
#5,532 zzhou612/jos/i386-jos-elf-binutils 4 0%
#5,533 hashlink --HEAD 4 0%
#5,534 anubisquantumcipher/tap/desktidy 4 0%
#5,535 shivammathur/extensions/amqp@8.5 4 0%
#5,536 s6-portable-utils 4 0%
#5,537 adelie-ai/adelie/adele-mac --HEAD 4 0%
#5,538 pothosware/pothos/pothoswidgets 4 0%
#5,539 semantic-reasoning/tap/wirelog 4 0%
#5,540 moves-rwth/storm/stormchecker --with-spot --with-tbb 4 0%
#5,541 iagooar/qqqa/qqqa 4 0%
#5,542 tcpreplay 4 0%
#5,543 nwoolls/xgminer/bfgminer 4 0%
#5,544 llvm-hs/llvm/llvm-3.8 4 0%
#5,545 harmonybrew/core/aerleon 4 0%
#5,546 mirri-code 4 0%
#5,547 snusxd/minfwm/minfwm 4 0%
#5,548 xmlstarlet 4 0%
#5,549 dnsrobocert 4 0%
#5,550 conda-lock 4 0%
#5,551 cloudsplaining 4 0%
#5,552 d12frosted/emacs-plus/emacs-plus@26 4 0%
#5,553 bandwidth/tap/band 4 0%
#5,554 hjdhjd/prismcast/prismcast 4 0%
#5,555 znapzend 4 0%
#5,556 brewsci/bio/multiqc 4 0%
#5,557 hatch 4 0%
#5,558 cxwx/cxbrew/code-whale 4 0%
#5,559 andreoliwa/formulae/nitpick 4 0%
#5,560 sysstat 4 0%
#5,561 recc 4 0%
#5,562 xh 4 0%
#5,563 awaistechnologist/tap/llm-sidecar 4 0%
#5,564 junkurihara/core/curl 4 0%
#5,565 marcqualie/nginx/nginx-full --with-accept-language-module --with-addition --with-auth-digest-module --with-auth-ldap-module --with-auth-req --with-autols-module --with-cache-purge-module --with-dav-ext-module --with-degredation --with-dosdetector-module --with-flv --with-geoip2-module --with-gunzip --with-gzip-static --with-headers-more-module --with-http2 --with-mail --with-mail-ssl --with-mp4 --with-pcre-jit --with-push-stream-module --with-random-index --with-realip --with-rtmp-module --with-secure-link --with-slice --with-status --with-stream --with-stream-realip --with-stream-ssl --with-stream-ssl-preread --with-sub --with-upload-module --with-upload-progress-module --with-vts-module --with-webdav 4 0%
#5,566 andriawan24/webp-converter/webp-convert 4 0%
#5,567 tschoonj/tap/xrmc 4 0%
#5,568 aimingeye/tap/halfvoice 4 0%
#5,569 d12frosted/emacs-plus/emacs-plus@29 --with-dragon-icon --with-native-comp 4 0%
#5,570 busy-tag/busytag/busytag-cli 4 0%
#5,571 heroku 4 0%
#5,572 cgreen-devs/cgreen/cgreen 4 0%
#5,573 notunrandom/cardano/kupo@2.11 4 0%
#5,574 alebcay/formula/muvm 4 0%
#5,575 wasi-runtimes 4 0%
#5,576 gofumpt 4 0%
#5,577 danvk/webdiff/webdiff 4 0%
#5,578 alebcay/ccextractor/ccextractor 4 0%
#5,579 macaulay2/tap/latte 4 0%
#5,580 ie-developers/ie/gnuplot --with-aquaterm 4 0%
#5,581 ryanfb/misc/libe57format 4 0%
#5,582 brad-x/custom/qemu@7 4 0%
#5,583 vidplace7/meshtastic/meshtasticd 4 0%
#5,584 brewsci/bio/fastp 4 0%
#5,585 cgif 4 0%
#5,586 max2github/msh/gnat-alire 4 0%
#5,587 clang-format --HEAD 4 0%
#5,588 aaronchartier/tap/inkjet 4 0%
#5,589 matinsaurralde/tap/mem 4 0%
#5,590 fradser/brew/event 4 0%
#5,591 rgsystemes/qt4/qt@4 --with-universal 4 0%
#5,592 osrf/simulation/gz-utils3 4 0%
#5,593 anirbanbasu/tap/ollama-downloader 4 0%
#5,594 dragfly/tap/dictare 4 0%
#5,595 tronbyt/tronbyt/pixlet 4 0%
#5,596 kunalkatariya/satori-cli/satori-cli 4 0%
#5,597 matcra587/tap/pagerduty-client --HEAD 4 0%
#5,598 valgrind 4 0%
#5,599 mswieboda/sfml/sfml@2.5 4 0%
#5,600 quantivue/outlook-notify/outlook-notify 4 0%
#5,601 ktfmt 4 0%
#5,602 jaewoook/nal/gh 4 0%
#5,603 gnu-chess --HEAD 4 0%
#5,604 homebank 4 0%
#5,605 afawe3331/globe/globe 4 0%
#5,606 gosec 4 0%
#5,607 amberframework/amber_cli/minecart 4 0%
#5,608 gecode 4 0%
#5,609 jsontypedef/jsontypedef/jtd-codegen 4 0%
#5,610 filosottile/musl-cross/musl-cross --without-aarch64 4 0%
#5,611 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-openssl@3 4 0%
#5,612 libgweather 4 0%
#5,613 cmarquardt/formulae/gdal 4 0%
#5,614 8b-is/tap/deepsiper-enthea 4 0%
#5,615 jswidler/tap/lockgit 4 0%
#5,616 libkiwix 4 0%
#5,617 leopher 4 0%
#5,618 ciaens/qobuz-player/qobuz-player 4 0%
#5,619 mc-rtc/mc-rtc/mc_rtc 4 0%
#5,620 secondcoolestguy/tap/ahola 4 0%
#5,621 nullhtp/voxcut/voxcut 4 0%
#5,622 vpn-slice 4 0%
#5,623 localsend-cli 4 0%
#5,624 qrupdate 4 0%
#5,625 shuttle-cli 4 0%
#5,626 shallow-backup 4 0%
#5,627 xtruder/tap/oo7 3 0%
#5,628 paramacode/tap/modux 3 0%
#5,629 asm-lsp 3 0%
#5,630 kunichiko/tap/cm6206-enabler 3 0%
#5,631 nmail 3 0%
#5,632 brewsci/bio/swipe 3 0%
#5,633 drafter --HEAD 3 0%
#5,634 mikefutia/creativeos/creativeos-connector 3 0%
#5,635 metview 3 0%
#5,636 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-dbus --with-imagemagick --with-mailutils --with-xwidgets 3 0%
#5,637 xcp 3 0%
#5,638 brewsci/bio/wish 3 0%
#5,639 ntl 3 0%
#5,640 shivammathur/extensions/interbase@7.2 3 0%
#5,641 qtbase --HEAD 3 0%
#5,642 bsnkhua/tap/vuvuzela 3 0%
#5,643 ispc 3 0%
#5,644 nervosnetwork/tap/libsecp256k1 3 0%
#5,645 osrf/simulation/gz-rotary-sensors --HEAD 3 0%
#5,646 y 3 0%
#5,647 quotatool 3 0%
#5,648 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-mailutils 3 0%
#5,649 entt 3 0%
#5,650 pavelnovichkov/tap/finiteflow 3 0%
#5,651 cyperx84/tap/flywheel 3 0%
#5,652 libraw --HEAD 3 0%
#5,653 dawncr0w/ios-simulator-mcp/ios-simulator-mcp 3 0%
#5,654 lsdvd 3 0%
#5,655 dboeke/tap/ash 3 0%
#5,656 oscarvarto/jank/llvm-head --HEAD 3 0%
#5,657 vrypan/tap/statusbar 3 0%
#5,658 shivammathur/extensions/interbase@7.1 3 0%
#5,659 faac 3 0%
#5,660 smallstep/smallstep/step 3 0%
#5,661 zhixuli0406/tap/duduclaw-beta 3 0%
#5,662 dstask 3 0%
#5,663 robotnetworks/tap/asp 3 0%
#5,664 sslh 3 0%
#5,665 dfstudio/dfstudio/docopt 3 0%
#5,666 anyzig 3 0%
#5,667 brewsci/bio/beast2 3 0%
#5,668 batt --HEAD 3 0%
#5,669 chkbit 3 0%
#5,670 raylib 3 0%
#5,671 bl4cc4t/vsplugins/vsp-temporalsoften2 --HEAD 3 0%
#5,672 npikall/tap/gotpm 3 0%
#5,673 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-libsoxr --with-libssh --with-libvmaf --with-openssl@3 --with-rubberband --with-tesseract --with-webp --with-whisper-cpp --with-zimg 3 0%
#5,674 asak 3 0%
#5,675 tinc-pre 3 0%
#5,676 divpreeet/whereisthis/whereisthis 3 0%
#5,677 davep/homebrew/tinboard 3 0%
#5,678 mac 3 0%
#5,679 elixir-tools/tap/next-ls 3 0%
#5,680 moonfruit/tap/serena 3 0%
#5,681 hlrs-vis/tap/vulkanscenegraph 3 0%
#5,682 eengl/nceplibs/nceplibs-bufr 3 0%
#5,683 streamrip 3 0%
#5,684 bobmatnyc/mcp-vector-search/mcp-vector-search 3 0%
#5,685 icemon 3 0%
#5,686 bochs 3 0%
#5,687 ripgrep --HEAD 3 0%
#5,688 node@14 3 0%
#5,689 kidanger/vpv/vpv --HEAD 3 0%
#5,690 rene-dev/sigrok/sigrok-firmware-fx2lafw 3 0%
#5,691 kaandedeoglu/formulae/shark 3 0%
#5,692 patelnav/ctrlspeak/ctrlspeak --with-nvidia 3 0%
#5,693 vapoursynth-bm3d 3 0%
#5,694 brewsci/bio/iva 3 0%
#5,695 cyclone-scheme/cyclone/cyclone 3 0%
#5,696 heihgm/bmatching/streaming 3 0%
#5,697 yohey/opencae/omlib-externalmedia 3 0%
#5,698 sujay2306/aws-iam-agent/iamscout 3 0%
#5,699 noworrieseh/brews/macdisp 3 0%
#5,700 shanberg/s/project-manager 3 0%
#5,701 harmonybrew/core/openblas 3 0%
#5,702 netheril96/fuse/securefs-mac 3 0%
#5,703 lol-html 3 0%
#5,704 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-no-title-bars --with-starter 3 0%
#5,705 bacula-fd 3 0%
#5,706 yazidears/wiiu/wiiu-audio 3 0%
#5,707 xgboost 3 0%
#5,708 xmbdfed 3 0%
#5,709 railwaycat/emacsmacport/emacs-mac@30exp --with-mac-metal --with-native-compilation --with-unlimited-select --with-xwidgets --without-tree-sitter@0.25 3 0%
#5,710 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 3 0%
#5,711 mht208/formal/cudd 3 0%
#5,712 secp256k1 3 0%
#5,713 jichu4n/palm-os/pilrc 3 0%
#5,714 ahobsonsayers/valve/vapoursynth-lsmas --HEAD 3 0%
#5,715 talm 3 0%
#5,716 nanopb 3 0%
#5,717 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#5,718 asc 3 0%
#5,719 dprint 3 0%
#5,720 pinentry-mac --HEAD 3 0%
#5,721 wcslib 3 0%
#5,722 amllx/mips64/mips64-elf-binutils 3 0%
#5,723 target-ops/tap/gitswitch 3 0%
#5,724 cloudflare/cloudflare/nginx 3 0%
#5,725 shivammathur/extensions/decimal@8.6 3 0%
#5,726 abinit/tap/qagate 3 0%
#5,727 m9h/neuro/charm-gems 3 0%
#5,728 forgejo 3 0%
#5,729 foreai-co/tap/forecli 3 0%
#5,730 pranjaltech/tools/scribe 3 0%
#5,731 kmilner/tap/tamarin-prover 3 0%
#5,732 shivammathur/extensions/imap@8.5 3 0%
#5,733 nailuogg/recoll/recoll 3 0%
#5,734 harmonybrew/core/doltgres 3 0%
#5,735 harmonybrew/core/cc-switch-cli 3 0%
#5,736 swag --HEAD 3 0%
#5,737 hlrs-vis/tap/dcmake 3 0%
#5,738 newsboat --HEAD 3 0%
#5,739 moon-buggy 3 0%
#5,740 vrypan/fario/fario 3 0%
#5,741 conftest 3 0%
#5,742 brewsci/science/ncl 3 0%
#5,743 endgame-build/legion/legion-cli 3 0%
#5,744 cake 3 0%
#5,745 blueutil --HEAD 3 0%
#5,746 legba 3 0%
#5,747 ninetrix-ai/tap/ninetrix 3 0%
#5,748 biosig 3 0%
#5,749 crescent617/tap/starsheep 3 0%
#5,750 nowplaying-cli 3 0%
#5,751 jvm-mon 3 0%
#5,752 d12frosted/emacs-plus/emacs-plus@32 --with-debug --with-mailutils 3 0%
#5,753 ffmpeg-vivid 3 0%
#5,754 tgragnato/tap/amule --HEAD 3 0%
#5,755 fockus/tap/memory-bank 3 0%
#5,756 xgo 3 0%
#5,757 mattiascibien/mason/mason 3 0%
#5,758 elan-init 3 0%
#5,759 aayush9029/tap/cast 3 0%
#5,760 emeryberger/hoard/libhoard --HEAD 3 0%
#5,761 bismark 3 0%
#5,762 jpwallace22/seed/seed 3 0%
#5,763 brewsci/bio/smina 3 0%
#5,764 scummvm 3 0%
#5,765 yubico-piv-tool 3 0%
#5,766 invoicetariff/tap/us-tariff-lookup 3 0%
#5,767 blades 3 0%
#5,768 cpprestsdk 3 0%
#5,769 pangomm@2.26.3 3 0%
#5,770 dpogue/plasma-deps/physx 3 0%
#5,771 jadonharsh109/tap/smriti 3 0%
#5,772 neverprepared/ink-bunny/brainbox 3 0%
#5,773 scc 3 0%
#5,774 juliancanaless/pane/pane 3 0%
#5,775 nickciolpan/tap/cli-snitch 3 0%
#5,776 mjmammoth/tap/whisper-local 3 0%
#5,777 h26forge 3 0%
#5,778 harmonybrew/core/cmake 3 0%
#5,779 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libssh --with-openssl --with-openssl@3 3 0%
#5,780 d12frosted/emacs-plus/emacs-plus@32 --with-compress-install 3 0%
#5,781 pango --HEAD 3 0%
#5,782 shigechika/tap/junos-ops 3 0%
#5,783 hashpump 3 0%
#5,784 baml 3 0%
#5,785 fx-upscale 3 0%
#5,786 parkerlab/tap/ataqv 3 0%
#5,787 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-icon --with-xwidgets 3 0%
#5,788 shipitswifty/tap/shipit 3 0%
#5,789 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libbluray --with-libgsm --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 3 0%
#5,790 brewsci/bio/trimadap 3 0%
#5,791 mcat 3 0%
#5,792 arustydev/tap/cargo-seek 3 0%
#5,793 gpatch 3 0%
#5,794 kwok 3 0%
#5,795 fbkarsdorp/lamachine/colibri-core 3 0%
#5,796 reneboygarcia/tap/twitdl --HEAD 3 0%
#5,797 bl4cc4t/vsplugins/vsp-temporalsoften2 3 0%
#5,798 bottom 3 0%
#5,799 kylerjensen/tap/headroom-ai 3 0%
#5,800 attipaci/pub/xchange 3 0%
#5,801 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-starter --with-xwidgets 3 0%
#5,802 fake-gcs-server 3 0%
#5,803 alanzeng423/tap/cfgsync 3 0%
#5,804 kubecm 3 0%
#5,805 prerakgada/tap/myna-daemon 3 0%
#5,806 evokoa/tap/pggraph 3 0%
#5,807 mvtiaine/repo/audacious-uade 3 0%
#5,808 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-modern-icon --with-native-compilation --with-starter --with-unlimited-select --with-xwidgets 3 0%
#5,809 davidchall/hep/nlojet++ 3 0%
#5,810 doltlite 3 0%
#5,811 apatero-org/tap/apatero 3 0%
#5,812 reoshiozawa/hajimu/hajimu 3 0%
#5,813 naosnz/ikiwiki/ikiwiki 3 0%
#5,814 tsduck --HEAD 3 0%
#5,815 harmonybrew/core/zsh 3 0%
#5,816 geeks-accelerator/ollama-herd/ollama-herd 3 0%
#5,817 krep 3 0%
#5,818 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-elmerice --without-mumps 3 0%
#5,819 nitaiaharoni1/tools/webscraper-cli 3 0%
#5,820 koekeishiya/formulae/skhd --HEAD 3 0%
#5,821 neved4/tap/iozone 3 0%
#5,822 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-mac-metal --with-modern-icon --with-native-comp 3 0%
#5,823 gastown 3 0%
#5,824 d12frosted/emacs-plus/emacs-plus@29 --with-compress-install --with-imagemagick --with-no-frame-refocus 3 0%
#5,825 trafilatura 3 0%
#5,826 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-blueshark --with-smartcard 3 0%
#5,827 quodlibet 3 0%
#5,828 tech-supportpremium/tap/invoice-generator 3 0%
#5,829 custom-install 3 0%
#5,830 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-librsvg --with-modern-icon --with-native-comp --with-xwidgets 3 0%
#5,831 kylerjensen/tap/claude-gateway 3 0%
#5,832 osrf/simulation/ogre2.3 3 0%
#5,833 bonjoski/tap/fabrial 3 0%
#5,834 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-natural-title-bar --with-starter --with-xwidgets 3 0%
#5,835 osgeo/osgeo4mac/osgeo-netcdf 3 0%
#5,836 python-gdbm@3.12 3 0%
#5,837 needle 3 0%
#5,838 python-gdbm@3.15 3 0%
#5,839 bl4cc4t/vsplugins/vsp-dfttest 3 0%
#5,840 iblinter 3 0%
#5,841 shivammathur/php/php@7.3-debug-zts 3 0%
#5,842 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-native-compilation --with-natural-title-bar --with-xwidgets --without-modules 3 0%
#5,843 swiftlint --HEAD 3 0%
#5,844 aws-checksums 3 0%
#5,845 whatweb 3 0%
#5,846 yle-dl 3 0%
#5,847 sourcekitten 3 0%
#5,848 tgrep 3 0%
#5,849 keyd 3 0%
#5,850 codemaster-ar/gemini_auth-electron/gemini-auth-electron 3 0%
#5,851 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-modern-sexy-v2-icon --with-xwidgets 3 0%
#5,852 vladasz/tap/virglrenderer 3 0%
#5,853 microsoft/mssql-release/msodbcsql18@18.4.1.1 3 0%
#5,854 arc86/dbrief/dbrief 3 0%
#5,855 highlight 3 0%
#5,856 licenseplist 3 0%
#5,857 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-debug 3 0%
#5,858 ctlptl 3 0%
#5,859 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libbluray --with-libflite --with-libplacebo --with-librsvg --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-svt-av1 --with-tensorflow --with-tesseract --with-webp --with-whisper-cpp --with-xvid 3 0%
#5,860 ta7mid/tap/reflect-cpp 3 0%
#5,861 wasmer 3 0%
#5,862 ratty 3 0%
#5,863 casacore/tap/casacore --HEAD --without-python 3 0%
#5,864 kabel/pecl/php@8.3-xdebug 3 0%
#5,865 cmigemo 3 0%
#5,866 patricktcoakley/formulae/gdvm 3 0%
#5,867 k-wrk/tap/cinder 3 0%
#5,868 tiny 3 0%
#5,869 stellar/tap/soroban-cli 3 0%
#5,870 brewsci/bio/trimmomatic 3 0%
#5,871 shirk33y/tap/llm-archive 3 0%
#5,872 harmonybrew/core/libbsd 3 0%
#5,873 wensheng/treader/treader 3 0%
#5,874 jstkdng/ueberzugpp/ueberzugpp 3 0%
#5,875 perl-dbd-mysql 3 0%
#5,876 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-native-comp 3 0%
#5,877 librdkafka 3 0%
#5,878 ecflow-ui 3 0%
#5,879 ast-grep/tap/ast-grep 3 0%
#5,880 bramstein/webfonttools/sfnt2woff 3 0%
#5,881 d12frosted/emacs-plus/emacs-plus@30 --with-modern-pen-icon 3 0%
#5,882 harmonybrew/core/mariadb 3 0%
#5,883 bold 3 0%
#5,884 outsinre/wrk2/wrk2 --HEAD 3 0%
#5,885 heggria/tap/agent-usage-atlas 3 0%
#5,886 nixfmt 3 0%
#5,887 andrewmd5/tap/dawn 3 0%
#5,888 rowedonalde/tap/modelherder 3 0%
#5,889 ezeoleaf/tap/termagotchi 3 0%
#5,890 brewsci/bio/kr 3 0%
#5,891 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-doom3-icon --with-native-comp 3 0%
#5,892 pmolfese/mesa-fix/mesa-xquartz-shm-fix 3 0%
#5,893 recon-ng 3 0%
#5,894 kubernetes-mcp-server 3 0%
#5,895 fcl 3 0%
#5,896 sqlx-cli 3 0%
#5,897 bison 3 0%
#5,898 thecolby/verbx/verbx 3 0%
#5,899 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#5,900 joplin-cli 3 0%
#5,901 rockymadden/rockymadden/slack-cli 3 0%
#5,902 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-dbus --with-mailutils --with-xwidgets 3 0%
#5,903 lii-enac/repo/smala 3 0%
#5,904 jopdorp/bigedit/bigedit 3 0%
#5,905 webmatze/tap/lazyollama 3 0%
#5,906 tele 3 0%
#5,907 supmover 3 0%
#5,908 applicaster/tap/zappifest 3 0%
#5,909 vishwam-chepuri/tap/claude-island 3 0%
#5,910 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-librist 3 0%
#5,911 kpkrisnop/flatcam-evo/flatcam-evo 3 0%
#5,912 denji/nginx/nginx-full --with-nchan-module 3 0%
#5,913 s3rj1k/qemu-virgl/libangle 3 0%
#5,914 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#5,915 guiguem/tap/midas 3 0%
#5,916 osgeo/osgeo4mac/osgeo-postgresql 3 0%
#5,917 zero8dotdev/tools/warp-cli 3 0%
#5,918 rqbit 3 0%
#5,919 maelvalais/amc/auto-multiple-choice 3 0%
#5,920 minizip-ng 3 0%
#5,921 caffreysun/tap/wesafechat 3 0%
#5,922 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libmodplug --with-libopenmpt --with-librist --with-librsvg --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 3 0%
#5,923 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#5,924 sqldef/sqldef/mssqldef 3 0%
#5,925 sphinx-doc --HEAD 3 0%
#5,926 blastpoint-inc/tap/postgis@3.6.0 3 0%
#5,927 rfidresearchgroup/proxmark3/proxmark3 --with-generic --with-small 3 0%
#5,928 lijialex/tap/claudometer 3 0%
#5,929 usbutils 3 0%
#5,930 sandrisestudio/musterd/musterd 3 0%
#5,931 takenpilot/cbor/cbor-cli 3 0%
#5,932 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 3 0%
#5,933 lemmy8495/tap/woist 3 0%
#5,934 weaviate-cli 3 0%
#5,935 nullclaw 3 0%
#5,936 eclipse-cdt/tools/lldb-mi 3 0%
#5,937 gentlebits/mlx-whisper-api/mlx-whisper-api 3 0%
#5,938 harmonybrew/core/keyutils 3 0%
#5,939 askender/tap/fansctl 3 0%
#5,940 iodigital-com/io/claudio 3 0%
#5,941 bcvk 3 0%
#5,942 shivammathur/extensions/igbinary@8.6 3 0%
#5,943 treefmt 3 0%
#5,944 statico/tap/llmac 3 0%
#5,945 basecamp/dev/openssl@1.0 3 0%
#5,946 nickustinov/tap/itsyhome 3 0%
#5,947 brewsci/bio/mlst 3 0%
#5,948 bevanjkay/formulae/skillspector 3 0%
#5,949 dua-cli 3 0%
#5,950 openparachutepbc/parachute/parachute 3 0%
#5,951 dyoburon/greppy/greppy 3 0%
#5,952 theapplegates/kleopatra6mac/kf6-kiconthemes 3 0%
#5,953 morpho-lang/morpho/morpho-cli 3 0%
#5,954 dustinwilson/tap/rsgain 3 0%
#5,955 vs-preview 3 0%
#5,956 gucharmap 3 0%
#5,957 olm 3 0%
#5,958 velero 3 0%
#5,959 akira-toriyama/tap/jig 3 0%
#5,960 denji/nginx/nginx-full --with-image-filter 3 0%
#5,961 axu2/kindletool/kindletool --HEAD 3 0%
#5,962 brunvonlope/core-fix/maxflow 3 0%
#5,963 fecabrera/mcc/mcc 3 0%
#5,964 brewsci/science/tophat 3 0%
#5,965 baguette 3 0%
#5,966 oldcrow/macos13-fixes/z3 3 0%
#5,967 xyzzy42/horology/tg-timer 3 0%
#5,968 loganbaek97/tap/claude-pet 3 0%
#5,969 brewsci/bio/kb-python 3 0%
#5,970 markoonakic/tap/tarnished-cli 3 0%
#5,971 mcap 3 0%
#5,972 johnnydep 3 0%
#5,973 sqlfluff 3 0%
#5,974 abcmidi 3 0%
#5,975 harmonybrew/core/protobuf 3 0%
#5,976 davidchall/hep/sherpa --with-root 3 0%
#5,977 spek 3 0%
#5,978 git-jiro/jiro/gridcoin --with-cli --without-gui 3 0%
#5,979 starlark-rust 3 0%
#5,980 cybernagle/cos/cos 3 0%
#5,981 llama-cpp-turbo --HEAD 3 0%
#5,982 scummvm --HEAD 3 0%
#5,983 dosbox-staging --HEAD 3 0%
#5,984 a7ex/formulae/xcresultparser@1.9.1 3 0%
#5,985 fastly 3 0%
#5,986 emeryberger/scalene/scalene --HEAD 3 0%
#5,987 bayandin/tap/ms-git 3 0%
#5,988 railwaycat/emacsmacport/emacs-mac@30exp --with-glib --with-librsvg --with-native-comp --with-xwidgets 3 0%
#5,989 colorscad 3 0%
#5,990 ngspice --HEAD 3 0%
#5,991 tsshd 3 0%
#5,992 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-debug --with-mailutils --with-xwidgets 3 0%
#5,993 bendews/tap/apw --HEAD 3 0%
#5,994 ksl-testing/tap/freebuff-cli 3 0%
#5,995 tariqwest/tap/apfel-plus 3 0%
#5,996 apjanke/openfoam/openfoam 3 0%
#5,997 tao3k/gerbil/gerbil-scheme 3 0%
#5,998 daviderestivo/emacs-head/emacs-head@32 3 0%
#5,999 libfyaml 3 0%
#6,000 mongodb/brew/libmongocrypt --HEAD 3 0%
#6,001 virt-manager 3 0%
#6,002 ciroarendt/codrsync/codrsync 3 0%
#6,003 behaviortree.cpp 3 0%
#6,004 cp2k 3 0%
#6,005 piermorel/bgfx/bgfx --HEAD 3 0%
#6,006 risingwavelabs/risingwave/risingwave --HEAD 3 0%
#6,007 zokirjonkodirov/arclink/arclink 3 0%
#6,008 shivammathur/extensions/xdebug@7.3 3 0%
#6,009 dyx884877791/i386-jos-elf-gcc/gcc5 3 0%
#6,010 aureuma/maclev/maclev 3 0%
#6,011 miky-rola/tap/meekilo --HEAD 3 0%
#6,012 libdbi-drivers --HEAD 3 0%
#6,013 mt32emu 3 0%
#6,014 sk 3 0%
#6,015 jql 3 0%
#6,016 paneru --HEAD 3 0%
#6,017 gittype 3 0%
#6,018 ginac 3 0%
#6,019 io41/tap/rmapi 3 0%
#6,020 erlfmt 3 0%
#6,021 z80oolong/eaw/rxvt-unicode@9999-dev 3 0%
#6,022 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,023 pgweb 3 0%
#6,024 davidchall/hep/hepmc3 --with-test 3 0%
#6,025 bbenchen/emacs-plus/emacs-plus@31 --with-alpha-background --with-blur-background --with-savchenkovaleriy-big-sur-icon --with-xwidgets 3 0%
#6,026 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-crash-debug --with-imagemagick --with-mailutils --with-modern-icon-nuvola --with-native-comp --with-tree-sitter --with-xwidgets 3 0%
#6,027 grafana/grafana/grafana-agent-flow 3 0%
#6,028 brewsci/science/gap 3 0%
#6,029 ossp-uuid 3 0%
#6,030 henriquebastos/tap/beans 3 0%
#6,031 isync --HEAD 3 0%
#6,032 scarb 3 0%
#6,033 sidneys/homebrew/openssl@1.0 --HEAD 3 0%
#6,034 docutils 3 0%
#6,035 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-natural-title-bar --with-starter 3 0%
#6,036 arthurpalves/m/coherent-swift 3 0%
#6,037 roxctl 3 0%
#6,038 node@16 3 0%
#6,039 geni 3 0%
#6,040 azurite 3 0%
#6,041 diff-pdf 3 0%
#6,042 httpyac 3 0%
#6,043 licensed 3 0%
#6,044 pyrefly 3 0%
#6,045 felixkratz/formulae/borders --HEAD 3 0%
#6,046 shivammathur/extensions/couchbase@8.3 3 0%
#6,047 nextdenovo 3 0%
#6,048 vincentkoc/tap/slacrawl 3 0%
#6,049 tiledb 3 0%
#6,050 gnome-papers 3 0%
#6,051 czkawka 3 0%
#6,052 cbyc/lexora/lexora-link 3 0%
#6,053 kevinalbs/brew/libmongocrypt 3 0%
#6,054 jankowtf/nano-remote/nanoremote-host 3 0%
#6,055 rggen 3 0%
#6,056 rabbitmq-c 3 0%
#6,057 keepkey-agent 3 0%
#6,058 mkmn/protobuf/protobuf@2.6 3 0%
#6,059 bl4cc4t/vsplugins/vsp-ffms2 --HEAD 3 0%
#6,060 deeplook/dirplot/dirplot 3 0%
#6,061 sunkencity999/blasphemer/blasphemer 3 0%
#6,062 adityagarg8/git-credential-email/git-credential-gmail 3 0%
#6,063 nvkudva/omni/omni 3 0%
#6,064 mulle-kybernetik/software/mulle-xcode-to-cmake 3 0%
#6,065 llvm-hs/llvm/llvm-13 3 0%
#6,066 macvip/mips-sde-elf/mips-sde-elf-binutils 3 0%
#6,067 docmd 3 0%
#6,068 shaderc --HEAD 3 0%
#6,069 grimme-lab/qc/test-drive 3 0%
#6,070 albingroen/logbench/logbench 3 0%
#6,071 edbrowse --HEAD 3 0%
#6,072 vitkabele/tap/mtn 3 0%
#6,073 sergio-prog/tap/chainq 3 0%
#6,074 cartman-kai/thrift/thrift@0.18 3 0%
#6,075 bitwuzla 3 0%
#6,076 git-gui 3 0%
#6,077 tychop/gitgulf/gitgulf 3 0%
#6,078 mburgs/pr-walkthrough/pr-walkthrough 3 0%
#6,079 uw-mrtud/mrtud/foray 3 0%
#6,080 netcdf-fortran 3 0%
#6,081 bgpstream 3 0%
#6,082 algol68g 3 0%
#6,083 peco 3 0%
#6,084 lucydodo/tap/sqlb-icu4c 3 0%
#6,085 jamiesmith/astronomy/gsc 3 0%
#6,086 z80oolong/vte/gnome-terminal@3.60.0 3 0%
#6,087 pkryger/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-spacemacs-icon --with-starter --with-unlimited-select 3 0%
#6,088 davidchall/hep/cernlib --with-test 3 0%
#6,089 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-librist --with-srt 3 0%
#6,090 sven42xyz/tap/gitls 3 0%
#6,091 pkryger/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-arc --with-imagemagick --with-optimization-flags --with-xwidgets 3 0%
#6,092 lgarron/lgarron/thirdparty-microcad --HEAD 3 0%
#6,093 itk 3 0%
#6,094 omihirofumi/tap/ww 3 0%
#6,095 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-native-comp --with-tree-sitter --without-libxml2 3 0%
#6,096 edholofy/tap/some1 3 0%
#6,097 uniterm 3 0%
#6,098 opensplat 3 0%
#6,099 heimdal 3 0%
#6,100 navi 3 0%
#6,101 gphoto2 3 0%
#6,102 dan-hart/tap/clings 3 0%
#6,103 nigelatdomain/rta/rta 3 0%
#6,104 scalr/scalr/scalr 3 0%
#6,105 tueda/form/form@4.3.0 3 0%
#6,106 runtimeverification/k/kframework 3 0%
#6,107 wxmaxima 3 0%
#6,108 macaulay2/tap/barvinok 3 0%
#6,109 d12frosted/emacs-plus/emacs-plus@30 --with-modern-orange-icon 3 0%
#6,110 mediaarea/mediaarea/rawcooked 3 0%
#6,111 carllee1983/tap/glance 3 0%
#6,112 satishbabariya/tap/sandbox 3 0%
#6,113 actionlint 3 0%
#6,114 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-native-comp --with-tree-sitter 3 0%
#6,115 robertelee78/unicornscan/unicornscan 3 0%
#6,116 ros/deps/yaml-cpp-0.3 3 0%
#6,117 typedb 3 0%
#6,118 osm2pgsql --HEAD 3 0%
#6,119 aground5/gdb-multiarch/gdb-multiarch 3 0%
#6,120 tuist/tuist/tuist@3.24.0 3 0%
#6,121 janorga/tap/tablefy 3 0%
#6,122 rockcraft 3 0%
#6,123 jack 3 0%
#6,124 adaptivecpp --HEAD 3 0%
#6,125 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-imagemagick --with-modern-alecive-flatwoken-icon --with-xwidgets 3 0%
#6,126 cubing/cubing/twips --HEAD 3 0%
#6,127 bbc/audiowaveform/audiowaveform 3 0%
#6,128 heroeslament/auther/auther 3 0%
#6,129 tcc 3 0%
#6,130 wildfly-as 3 0%
#6,131 dmd 3 0%
#6,132 cfssl 3 0%
#6,133 secretspec --HEAD 3 0%
#6,134 models 3 0%
#6,135 opencamp-hq/opencamp/opencamp 3 0%
#6,136 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-imagemagick --with-mailutils 3 0%
#6,137 brewsci/bio/foldmason 3 0%
#6,138 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,139 imake 3 0%
#6,140 arakiss/tap/eldr 3 0%
#6,141 publicexcess/ijah/ijah 3 0%
#6,142 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-modern-icon --with-xwidgets 3 0%
#6,143 gexiv2 3 0%
#6,144 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-no-title-bars --with-starter 3 0%
#6,145 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libbluray --with-libgsm --with-librsvg --with-libssh --with-libxml2 --with-opencore-amr --with-openjpeg --with-openssl --with-rav1e --with-speex --with-srt --with-tesseract --with-webp 3 0%
#6,146 gh-slimify 3 0%
#6,147 ghq 3 0%
#6,148 willyv3/tap/todobi 3 0%
#6,149 davidchall/hep/herwig --with-test 3 0%
#6,150 riscv64-elf-gdb 3 0%
#6,151 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-libaribb24 --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,152 drpedapati/tap/sciclaw 3 0%
#6,153 petere/postgresql/postgresql@18 3 0%
#6,154 1morebuild/tap/byr-pt-cli 3 0%
#6,155 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,156 mikessh/repseq/vdjtools 3 0%
#6,157 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,158 frankieew/tap/sfeed 3 0%
#6,159 guryn/tap/cove 3 0%
#6,160 sschlesier/csvutils/csvquote 3 0%
#6,161 eengl/nceplibs/nceplibs-wgrib2 3 0%
#6,162 punt-labs/tap/biff 3 0%
#6,163 sipp 3 0%
#6,164 amanharshx/tap/clipfit 3 0%
#6,165 qtmqtt 3 0%
#6,166 kurtlehnardt/tools/granted 3 0%
#6,167 libdap --HEAD 3 0%
#6,168 keith/formulae/sourcekit-lsp 3 0%
#6,169 kubernetes-cli@1.35 3 0%
#6,170 oscleaner 3 0%
#6,171 bl4cc4t/vsplugins/vsp-flash3kyuu_deband --HEAD 3 0%
#6,172 petere/postgresql/postgresql@16 3 0%
#6,173 synnada-ai/synnada/agency 3 0%
#6,174 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-imagemagick 3 0%
#6,175 hamlib 3 0%
#6,176 z3ntu/openrazer/razer_test 3 0%
#6,177 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-crash-debug --with-imagemagick --with-mailutils --with-modern-icon-nuvola --with-native-comp --with-tree-sitter --with-xwidgets 3 0%
#6,178 pulseaudio --HEAD 3 0%
#6,179 dbcsr 3 0%
#6,180 materializeinc/crosstools/x86_64-unknown-linux-gnu 3 0%
#6,181 fwdekker/mommy/mommy 3 0%
#6,182 rosa-cli 3 0%
#6,183 silimate/silimate/tcl-tk@8 3 0%
#6,184 dlr-ts/sumo/sumo@1.18.0 3 0%
#6,185 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-no-frame-refocus --with-xwidgets 3 0%
#6,186 gcc@7 3 0%
#6,187 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-modern-icon --with-xwidgets 3 0%
#6,188 norbert515/tap/vide 3 0%
#6,189 libsidplayfp --HEAD 3 0%
#6,190 open-simh 3 0%
#6,191 choose-gui 3 0%
#6,192 d12frosted/emacs-plus/emacs-plus@29 --with-native-comp --with-spacemacs-icon 3 0%
#6,193 aaratha/emacs-plus/emacs-plus@31 --with-dbus --with-imagemagick --with-mailutils --with-native-comp --with-xwidgets 3 0%
#6,194 qwwdfsad/tap/hsdis 3 0%
#6,195 fern-api 3 0%
#6,196 d12frosted/emacs-plus/emacs-plus@29 --with-modern-black-dragon-icon 3 0%
#6,197 brewsci/bio/mapcaller 3 0%
#6,198 lifepillar/appleii/jvernet-catakig 3 0%
#6,199 lifepillar/appleii/ii-pix 3 0%
#6,200 mutt 3 0%
#6,201 infisical 3 0%
#6,202 hashlink 3 0%
#6,203 crates-tui 3 0%
#6,204 outof-place/tap/claude-acc 3 0%
#6,205 libfuse --HEAD 3 0%
#6,206 technitium-dns 3 0%
#6,207 rdp/openssh-gssapi/openssh-patched --with-keychain-support 3 0%
#6,208 cmshinkle/scripture-to-slides/scripture-to-slides 3 0%
#6,209 latexindent 3 0%
#6,210 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-icons-project-EmacsIcon7 --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-starter --with-unlimited-select --with-xwidgets 3 0%
#6,211 libyuv 3 0%
#6,212 tueda/loops/libfermat --HEAD 3 0%
#6,213 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --without-cocoa 3 0%
#6,214 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-xwidgets 3 0%
#6,215 zhenyufu/tap/spacelight 3 0%
#6,216 upendrasengar/jarvis/jarvis 3 0%
#6,217 labstreaminglayer/tap/lsl --HEAD 3 0%
#6,218 vinn-ie/openems/fparser 3 0%
#6,219 deponian/tap/logalize 3 0%
#6,220 lobster 3 0%
#6,221 gfold 3 0%
#6,222 zimg 3 0%
#6,223 ublue-os/experimental-tap/libvirt-full 3 0%
#6,224 slp/krun/krunai 3 0%
#6,225 d12frosted/emacs-plus/emacs-plus@30 --with-c9rgreen-sonoma-icon --with-imagemagick --with-xwidgets 3 0%
#6,226 posting 3 0%
#6,227 dislocker-git --HEAD 3 0%
#6,228 shopify/shopify/shopify-cli@3 3 0%
#6,229 nip4 3 0%
#6,230 wasmrun 3 0%
#6,231 ivoronin/ivoronin/ec2ssh 3 0%
#6,232 dekit 3 0%
#6,233 irrlicht --HEAD 3 0%
#6,234 kraftkit 3 0%
#6,235 aayushprime/apps/bgr 3 0%
#6,236 thedreamer/tap/openjdk 3 0%
#6,237 josephburgess/formulae/gust 3 0%
#6,238 obverser/zathura/zathura --with-synctex 3 0%
#6,239 obverser/zathura/zathura --HEAD --with-synctex 3 0%
#6,240 gromgit/fuse/dwarfs-fuse-mac 3 0%
#6,241 karthikeyjoshi/bsh/bsh 3 0%
#6,242 hlrs-vis/tap/vsgimgui 3 0%
#6,243 cartr/qt4/poppler-qt4 3 0%
#6,244 numbatt/tap/gh-wallpaper 3 0%
#6,245 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-imagemagick --with-modern-icon-alecive-flatwoken --with-native-comp --with-pdumper --with-tree-sitter --with-xwidgets 3 0%
#6,246 mht208/formal/boolector 3 0%
#6,247 nigeldaniels/ros2-kilted/ros2-kilted-core 3 0%
#6,248 immich-go 3 0%
#6,249 pypy3.9 3 0%
#6,250 go-hass-agent 3 0%
#6,251 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-mailutils --with-xwidgets 3 0%
#6,252 michael00kir/martini/martini 3 0%
#6,253 libpg_query 3 0%
#6,254 antoninsiska/cj-corrector/cj-corrector 3 0%
#6,255 millet 3 0%
#6,256 pugi-io/tap/pugi 3 0%
#6,257 anyme/claude-meter/claude-meter 3 0%
#6,258 dedev-llc/rpr/rpr 3 0%
#6,259 ecmwf/ecmwf/eckit 3 0%
#6,260 d99kris/nchat/nchat --HEAD 3 0%
#6,261 nilm987521/tools/adt 3 0%
#6,262 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,263 redswoop/input-leap/input-leap 3 0%
#6,264 poppler --HEAD 3 0%
#6,265 shivammathur/extensions/interbase@7.0 3 0%
#6,266 mihomo --HEAD 3 0%
#6,267 judgmentlabs/tap/judgment-cli 3 0%
#6,268 jackielii/tap/skhd-zig --HEAD 3 0%
#6,269 hjr265/gittop/gittop 3 0%
#6,270 openrtm/openrtm2/openrtm2-python-py311 3 0%
#6,271 magic-wormhole 3 0%
#6,272 himself65/xhs/xhs-cli 3 0%
#6,273 dsk53910/capture-pipeline/capture-pipeline 3 0%
#6,274 16bitdo/anvyc/anvyc 3 0%
#6,275 utgarda/correct-unicorn/correct-unicorn 3 0%
#6,276 shivammathur/php/php@7.2-debug-zts 3 0%
#6,277 shivammathur/php/php@7.0-zts 3 0%
#6,278 shivammathur/php/php@7.0-debug 3 0%
#6,279 opensc 3 0%
#6,280 yunusemreyakisan/tap/garbageman 3 0%
#6,281 shivammathur/php/php@7.4-debug-zts 3 0%
#6,282 libglade 3 0%
#6,283 karlsruhegraphgeneration/kagen/kagen 3 0%
#6,284 osrf/simulation/gz-rendering10 3 0%
#6,285 matthewp/rosie/rosie 3 0%
#6,286 drbild/bacnet/bacnet 3 0%
#6,287 tree-sitter --HEAD 3 0%
#6,288 sql-formatter 3 0%
#6,289 libical 3 0%
#6,290 merchloubna70-dot/autodev/autodev-ai 3 0%
#6,291 dasel 3 0%
#6,292 lcs --HEAD 3 0%
#6,293 m9h/neuro/compucell3d 3 0%
#6,294 zumpchke/mrcal/mrcal 3 0%
#6,295 mono-libgdiplus 3 0%
#6,296 ntfs-3g --HEAD 3 0%
#6,297 icann-rdap 3 0%
#6,298 thecolby/pvx/pvx --HEAD 3 0%
#6,299 molikano/sandokan/sandokan 3 0%
#6,300 d12frosted/emacs-plus/emacs-plus@30 --with-EmacsIcon2-icon 3 0%
#6,301 docker-engine 3 0%
#6,302 brewsci/bio/clustal-omega 3 0%
#6,303 shivammathur/extensions/interbase@7.3 3 0%
#6,304 freecad/freecad/pyside6_py313 3 0%
#6,305 saravieira/tap/img2gba 3 0%
#6,306 coidemo/textffcut/textffcut 3 0%
#6,307 gitea --HEAD 3 0%
#6,308 chountalas/tap/redline 3 0%
#6,309 open-babel --HEAD 3 0%
#6,310 zlint 3 0%
#6,311 localmaxmatching/localmaxmatching/localmaxmatching 3 0%
#6,312 tgtakaoka/m6809/binutils-m6809 3 0%
#6,313 shivammathur/extensions/firebird-client 3 0%
#6,314 programmerin-wonderland/raff/kf5-kfilemetadata 3 0%
#6,315 okeanos/tap/blesh --HEAD 3 0%
#6,316 carthage --HEAD 3 0%
#6,317 parallel --HEAD 3 0%
#6,318 educelab/code/registration-toolkit 3 0%
#6,319 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-big-sur-icon --with-imagemagick --with-mac-metal --with-starter --with-xwidgets 3 0%
#6,320 rayriffy/taps/dictionary_generator 3 0%
#6,321 boolector 3 0%
#6,322 povray 3 0%
#6,323 cloud-officer/ci/citools 3 0%
#6,324 mahiler1909/tools/claudepath 3 0%
#6,325 maximbilan/podcrack/podcrack 3 0%
#6,326 brewsci/bio/busco 3 0%
#6,327 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-glib --with-librsvg --with-mac-metal --with-native-comp --with-unlimited-select 3 0%
#6,328 cloudo/tap/cburn 3 0%
#6,329 tectonic --HEAD 3 0%
#6,330 steamguard-cli 3 0%
#6,331 dotdrop 3 0%
#6,332 simnalamburt/x/gitstatus 3 0%
#6,333 libngspice 3 0%
#6,334 lpeg 3 0%
#6,335 galaxyhaze/zithc/zithc 3 0%
#6,336 nzbget 3 0%
#6,337 jabbas/aivectormemory/aivectormemory 3 0%
#6,338 lastlookdev/tap/ios-mcp-server 3 0%
#6,339 chopiou/namloader/namloader 3 0%
#6,340 vdirsyncer 3 0%
#6,341 dhall-lsp-server 3 0%
#6,342 kubeseal 3 0%
#6,343 aegro/aegro-cli/aegro 3 0%
#6,344 alphatechlab/tap/webmux 3 0%
#6,345 systemcraftsman/strimzi-kafka-cli/strimzi-kafka-cli 3 0%
#6,346 libfaketime 3 0%
#6,347 tomtom-international/taps/cmake@3.13 3 0%
#6,348 drfill/liquidsoap/soundtouch 3 0%
#6,349 autonomic-ai-dev/tap/autonomic-stack 3 0%
#6,350 xianxu/pair/pair 3 0%
#6,351 libxext 3 0%
#6,352 pulp-cli 3 0%
#6,353 et 3 0%
#6,354 skyzyx/ffmpeg/ffmpeg-skyzyx 3 0%
#6,355 dehancer/brew/opencv410_dehancer 3 0%
#6,356 giavascript/giavascript/giavascript 3 0%
#6,357 kaito-tokyo/kaito-tokyo/kaito-tokyo-pybind11@3.0.3 3 0%
#6,358 chunkah 3 0%
#6,359 harmonybrew/core/jadx 3 0%
#6,360 edgarcosta/math/gmp-ecm 3 0%
#6,361 xanaxxxxxx/tap/ghostty-toggle 3 0%
#6,362 ko 3 0%
#6,363 gf2x 3 0%
#6,364 dwcaress/mbsystem/mbsystem-newgui 3 0%
#6,365 pmtiles 3 0%
#6,366 regclient 3 0%
#6,367 sqldiff 3 0%
#6,368 scoutsuite 3 0%
#6,369 sqlite-rsync 3 0%
#6,370 jpc-av/av-spex/av-spex 3 0%
#6,371 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 3 0%
#6,372 jessecar96/ffmpeg/ffmpeg --with-dvd 3 0%
#6,373 gretel/sdr/soapyuhd 3 0%
#6,374 stgit 3 0%
#6,375 brad-x/custom/vmctl 3 0%
#6,376 mdcat 3 0%
#6,377 salesforce-mcp 3 0%
#6,378 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-dbus --with-xwidgets 3 0%
#6,379 libgedit-tepl 3 0%
#6,380 gloiiire/cocker/cocker 3 0%
#6,381 bitpeppr/formulae/trisolaris 3 0%
#6,382 dzfrias/formulae/projectable 3 0%
#6,383 zizmor 3 0%
#6,384 cloudformation-guard 3 0%
#6,385 bacchusgift/tap/sql-diff 3 0%
#6,386 libdbi-drivers --HEAD --with-mariadb --with-sqlite 3 0%
#6,387 id3lib 3 0%
#6,388 brewsci/bio/sibelia 3 0%
#6,389 c0rmac/involute/involute 3 0%
#6,390 osrf/simulation/sofa 3 0%
#6,391 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libsoxr 3 0%
#6,392 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-srt 3 0%
#6,393 mo-tenstorrent/tools/tracy-experimental 3 0%
#6,394 inlyne 3 0%
#6,395 vaibhav-mattoo/bitchat-tui/bitchat-tui 3 0%
#6,396 brewsci/science/ticcutils 3 0%
#6,397 libcanberra 3 0%
#6,398 railwaycat/emacsmacport/emacs-mac@29 --with-glib 3 0%
#6,399 mzxzd/janet-opencode/janet-opencode-bundle --HEAD 3 0%
#6,400 futuro/brew/cyrus-sasl-w-xoauth2-plugin 3 0%
#6,401 kylerjensen/tap/headroom 3 0%
#6,402 libtommath 3 0%
#6,403 datastax/astra-cli/astra-cli 3 0%
#6,404 artemeon/php/php@8.2 3 0%
#6,405 unipheas/barkeep/barkeep 3 0%
#6,406 typedb/tap-test/typedb-snapshot 3 0%
#6,407 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-imagemagick --with-modern-icon-sjrmanning --with-native-comp --with-native-full-aot --with-pdumper --with-tree-sitter 3 0%
#6,408 david0/audio/x42-plugins --HEAD 3 0%
#6,409 replicate/tap/replicate 3 0%
#6,410 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-native-comp --with-tree-sitter --with-xwidgets 3 0%
#6,411 libdvdnav 3 0%
#6,412 xiaoleiy/tap/podpull 3 0%
#6,413 dasysad/tap/attache 3 0%
#6,414 telepresenceio/telepresence/telepresence-oss --with-daemon 3 0%
#6,415 abi3audit 3 0%
#6,416 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-native-compilation --with-starter --with-xwidgets 3 0%
#6,417 wsmontes/onenote/onenote2md 3 0%
#6,418 akrap147/akrap/algo 3 0%
#6,419 shlomiuziel/tap/sonosh 3 0%
#6,420 shivammathur/extensions/uopz@8.4 3 0%
#6,421 satococoa/tap/git-worktreeinclude 3 0%
#6,422 the-protobuf-project/tap/protoc-gen-python-gapic 3 0%
#6,423 knu/knu/voicevox-engine 3 0%
#6,424 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,425 fail2ban 3 0%
#6,426 rafifos/tap/airsync-mac --HEAD 3 0%
#6,427 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-modern-icon-emacs-icon4 --with-native-comp 3 0%
#6,428 libdecor 3 0%
#6,429 mongocli 3 0%
#6,430 zenith 3 0%
#6,431 tne-ai/tne-tap/mlflow 3 0%
#6,432 qtcanvaspainter 3 0%
#6,433 anirudhg07/anirudhg07/typeinc 3 0%
#6,434 gitg 3 0%
#6,435 asyncapi 3 0%
#6,436 lldb-mi 3 0%
#6,437 nicotine-plus 3 0%
#6,438 rtimush/tap/tenpureto 3 0%
#6,439 lkrms/misc/gp-saml-gui --HEAD 3 0%
#6,440 cutadapt 3 0%
#6,441 ska-sa/tap/casacore --HEAD --with-python 3 0%
#6,442 shiloong/tap/tokenless 3 0%
#6,443 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,444 daviderestivo/emacs-head/emacs-head@30 --with-cocoa 3 0%
#6,445 sshuttle --HEAD 3 0%
#6,446 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,447 hobbithacker/q3270/q3270 3 0%
#6,448 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-native-compilation --without-modules 3 0%
#6,449 proxsuite 3 0%
#6,450 rustledger 3 0%
#6,451 joeyhoer/extras/pup 3 0%
#6,452 kops 3 0%
#6,453 atuin --HEAD 3 0%
#6,454 socheatsok78/tap/gon 3 0%
#6,455 glew --HEAD 3 0%
#6,456 tuisky 3 0%
#6,457 dldash/core/docker-color-output 3 0%
#6,458 harmonybrew/core/gnu-getopt 3 0%
#6,459 tam5/emacs-plus/emacs-plus@30 --with-debug 3 0%
#6,460 kiwix-tools 3 0%
#6,461 z80oolong/eaw/nano-current --HEAD 3 0%
#6,462 vigilant-llc/tap/fwknop 3 0%
#6,463 osrf/simulation/gz-launch9 3 0%
#6,464 sf 3 0%
#6,465 kdeps 3 0%
#6,466 docdyhr/tap/macwhisper-mcp-server 3 0%
#6,467 agda --HEAD 3 0%
#6,468 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libaribb24 --with-libplacebo --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-openjpeg --with-rav1e --with-rubberband --with-tesseract --with-webp --with-zeromq 3 0%
#6,469 texlive --HEAD 3 0%
#6,470 cblecker/tap/ocm-backplane 3 0%
#6,471 macaulay2/tap/frobby 3 0%
#6,472 nick-rakoczy/tap/meta-git 3 0%
#6,473 mesh-llm 3 0%
#6,474 datui 3 0%
#6,475 parasxos/tap/apple-mail-mcp 3 0%
#6,476 tpwo/vobsub2srt/vobsub2srt --HEAD 3 0%
#6,477 neethack --HEAD 3 0%
#6,478 sh0nk/tap/man-japanese 3 0%
#6,479 votca 3 0%
#6,480 markoboskoauroville/pasty/pasty --HEAD 3 0%
#6,481 pol-cova/tap/observe 3 0%
#6,482 pasogott/tap/frappecli 3 0%
#6,483 personalrobotics/tap/boost_numpy_eigen 3 0%
#6,484 shivammathur/php/php@8.5 3 0%
#6,485 harmonybrew/core/iputils 3 0%
#6,486 gary149/llama-agent/llama-agent --HEAD 3 0%
#6,487 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-imagemagick --with-modern-icon-papirus --with-native-comp --with-native-full-aot --with-pdumper --with-tree-sitter --with-xwidgets 3 0%
#6,488 batterii/haproxy-lua/haproxy 3 0%
#6,489 picoclaw 3 0%
#6,490 mx 3 0%
#6,491 cargo-hack 3 0%
#6,492 kenshinnguyen/tap/mpv 3 0%
#6,493 dholm/sdr/cubicsdr --HEAD 3 0%
#6,494 benparker-dev/mysql-tap/mysql@5.7 3 0%
#6,495 linkerd --HEAD 3 0%
#6,496 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,497 lvdmauten/tap/cunt 3 0%
#6,498 harmonybrew/core/asciidoctorj 3 0%
#6,499 soar 3 0%
#6,500 connorodea/tap/openrouter-toolkit 3 0%
#6,501 epoll-shim 3 0%
#6,502 startergo/qemu-virgl/qemu-virgl 3 0%
#6,503 zhixuli0406/tap/duduclaw 3 0%
#6,504 b3sum 3 0%
#6,505 flite 3 0%
#6,506 mdterm 3 0%
#6,507 ezagent42/zchat/zchat 3 0%
#6,508 hamidi-dev/tap/opentab 3 0%
#6,509 aliyun/agentbay/agentbay 3 0%
#6,510 holy-coders/chewy/sd-cpp 3 0%
#6,511 josephholsten/josephholsten/flor 3 0%
#6,512 khr898/ntfsmac/ntfsmac --HEAD 3 0%
#6,513 tgtakaoka/mspgcc/gcc-msp430 3 0%
#6,514 harmonybrew/core/socat 3 0%
#6,515 davidchall/hep/herwig 3 0%
#6,516 supervisor 3 0%
#6,517 sidaf/pentest/hashcat-legacy 3 0%
#6,518 itorz7/tap/et-plus 3 0%
#6,519 slp/krunkit/angle-krunkit 3 0%
#6,520 midnight-commander --HEAD 3 0%
#6,521 brunvonlope/core-fix/libheif 3 0%
#6,522 sqlite3-to-mysql 3 0%
#6,523 shivammathur/extensions/ssh2@8.6 3 0%
#6,524 shivammathur/extensions/phpredis@8.6 3 0%
#6,525 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,526 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-debug --with-imagemagick --with-mailutils --with-xwidgets 3 0%
#6,527 lazycut 3 0%
#6,528 arcane-cli 3 0%
#6,529 vegastrike/vegastrike/imgui 3 0%
#6,530 nftables 3 0%
#6,531 eshap09/rag/rag 3 0%
#6,532 pdns 3 0%
#6,533 jayanaxhf/zathura/zathura --with-no-titlebar --with-synctex 3 0%
#6,534 punitlad/tap/vdi-babysitter-dev 3 0%
#6,535 arylen/libresprite/libresprite 3 0%
#6,536 sift 3 0%
#6,537 kietnguyenvulcanlabs/tap/shield-pr 3 0%
#6,538 langgenius/dify/dify 3 0%
#6,539 jpeach/dreamcast/dc-toolchain-stable 3 0%
#6,540 dps8m 3 0%
#6,541 sqlpage 3 0%
#6,542 corvus400/video-capture-mcp/video-capture-mcp 3 0%
#6,543 harmonybrew/core/python@3.13 3 0%
#6,544 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,545 mur-run/tap/mur 3 0%
#6,546 msgpack-tools 3 0%
#6,547 denji/nginx/openresty-openssl 3 0%
#6,548 coral 3 0%
#6,549 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 3 0%
#6,550 emerleite/tap/d1cli 3 0%
#6,551 imagemagick-full --HEAD 3 0%
#6,552 subediparas5/tap/lsport 3 0%
#6,553 oasdiff 3 0%
#6,554 bnomei/chromewright/chromewright 3 0%
#6,555 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-imagemagick --with-mailutils 3 0%
#6,556 eunomia-bpf/tap/agentsight 3 0%
#6,557 iqtree3 3 0%
#6,558 ssulser/local/vbisam --HEAD 3 0%
#6,559 temporalio/prerelease/temporal-cloud 3 0%
#6,560 gromgit/fuse/simple-mtpfs-mac 3 0%
#6,561 pietroperona/night-agent/night-agent 3 0%
#6,562 harmonybrew/core/ada-url 3 0%
#6,563 coin-or-tools/coinor/cbc 3 0%
#6,564 swiftgen 3 0%
#6,565 podman --HEAD 3 0%
#6,566 dpo/openblas/scalapack 3 0%
#6,567 vivaan-dhawan/diffly-cli/diffly-cli 3 0%
#6,568 libkrun/krun/buildah 3 0%
#6,569 cloudamqp/cloudamqp/sparoid 3 0%
#6,570 boxes 3 0%
#6,571 dxc 3 0%
#6,572 harmonybrew/core/fresh-editor 3 0%
#6,573 blindlobstar/tap/cicdez 3 0%
#6,574 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libvmaf --with-rav1e --with-tesseract --with-webp 3 0%
#6,575 jrepp/stackimport/stackimport 3 0%
#6,576 minprog/pkg/pup 3 0%
#6,577 bogdan-d/tap/rocm-smi-lib 3 0%
#6,578 gavi/monmon/monmon 3 0%
#6,579 bl4cc4t/vsplugins/vsp-ffms2 3 0%
#6,580 jackharvest/tap/bt820 3 0%
#6,581 menci/libvirt-m1/virt-viewer 3 0%
#6,582 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,583 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,584 technical-1/tap/shopify-atc 3 0%
#6,585 tinned-alt/tools/obsidian-notes-agent 3 0%
#6,586 myzhang1029/myzhang1029/caida-spoofer 3 0%
#6,587 goku 3 0%
#6,588 franklinchen/tap/cm3 3 0%
#6,589 nativeos/i386-elf-toolchain/i386-elf-gcc@11.1 3 0%
#6,590 yalantinglibs 3 0%
#6,591 overtls 3 0%
#6,592 null-dev/firefox-profile-switcher/firefox-profile-switcher-connector 3 0%
#6,593 dgarnier/plasma/parmetis 3 0%
#6,594 harmonybrew/core/apache-serf 3 0%
#6,595 scaryrawr/formulae/codex 3 0%
#6,596 henceman777/tap/meetap 3 0%
#6,597 pbkit/tap/pbkit 3 0%
#6,598 bluetuith 3 0%
#6,599 arustydev/tap/gittype 3 0%
#6,600 brewsci/bio/plink 3 0%
#6,601 aurelian-shuttleworth/tools/agent-ear 3 0%
#6,602 liliang-cn/anywhere/anywhered 3 0%
#6,603 kdash 3 0%
#6,604 cxwx/cxbrew/mcmc --HEAD 3 0%
#6,605 data-wise/tap/agy 3 0%
#6,606 tjameswilliams/tap/ai-imessage 3 0%
#6,607 rancher-cli 3 0%
#6,608 halilertekin/tap/claude-code-router-config 3 0%
#6,609 detrin/tap/brow 3 0%
#6,610 ecmwf/ecmwf/odc 3 0%
#6,611 jackuait/ghost-tab/ghost-tab 3 0%
#6,612 tne-ai/tne-tap/litellm 3 0%
#6,613 lutok 3 0%
#6,614 deark 3 0%
#6,615 libgphoto2 3 0%
#6,616 nim --HEAD 3 0%
#6,617 harmonybrew/core/node@24 3 0%
#6,618 gromgit/dev/redbean 3 0%
#6,619 pcsx-redux/mips/mipsel-none-elf-gcc 3 0%
#6,620 superseedr 3 0%
#6,621 a-elhaag/driftshell/drift 3 0%
#6,622 thesampadilla/montaj/montaj 3 0%
#6,623 exact-image 3 0%
#6,624 fsouza/prettierd/prettierd 3 0%
#6,625 zhongruoyu/tap/shorten 3 0%
#6,626 advancecomp 3 0%
#6,627 florentiu/lexis/lexis --HEAD 3 0%
#6,628 paperfoot/tap/stamp-cli 3 0%
#6,629 yofriadi/tap/pi-agent-rust 3 0%
#6,630 libspatialite 3 0%
#6,631 chrismear/mysql/mysql@5.7 3 0%
#6,632 undivisible/tap/poke-around --HEAD 3 0%
#6,633 gom 3 0%
#6,634 gillisd/tap/duckdb 3 0%
#6,635 callumdeas/wt/wt 3 0%
#6,636 kojix2/brew/chatgpt-cli 3 0%
#6,637 mysql-client@9.7 3 0%
#6,638 boost-mpi 3 0%
#6,639 ooniprobe 3 0%
#6,640 ejabberd 3 0%
#6,641 gumadeiras/tap/fruitloops 3 0%
#6,642 marceljj/tap/gnu-cursynth 3 0%
#6,643 shivammathur/extensions/couchbase@8.4 3 0%
#6,644 carllee1983/tap/ai-usage-monitor 3 0%
#6,645 shivammathur/extensions/couchbase@8.1 3 0%
#6,646 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-gcc --with-hypre --with-openmp --without-mumps --without-open-mpi 3 0%
#6,647 solodevcool/tifa-mysql/tifa-mysql@8.0 3 0%
#6,648 sidneys/homebrew/untrunc --HEAD 3 0%
#6,649 cfr-decompiler 3 0%
#6,650 heavywatal/tap/tumopp 3 0%
#6,651 distill-cli 3 0%
#6,652 code-cli 3 0%
#6,653 couchdb 3 0%
#6,654 thrax 3 0%
#6,655 osslsigncode 3 0%
#6,656 openrtsp 3 0%
#6,657 shivammathur/extensions/v8js@8.0 3 0%
#6,658 jakkusakura/kde/kf5-karchive 3 0%
#6,659 jo95017/openclaudia/serena 3 0%
#6,660 edgcpp 3 0%
#6,661 dimpase/gap/gap 3 0%
#6,662 dimpase/tap/brial 3 0%
#6,663 ltex-ls-plus --HEAD 3 0%
#6,664 dominikschlosser/tap/eudi-dev 3 0%
#6,665 exolnet/deprecated/php@5.6 3 0%
#6,666 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-dbus --with-debug --with-xwidgets 3 0%
#6,667 shivammathur/extensions/ds@8.6 3 0%
#6,668 parse-dmarc 3 0%
#6,669 vbindiff 3 0%
#6,670 builderio/dev-tools/dev-tools 3 0%
#6,671 get-capec 3 0%
#6,672 railwaycat/emacsmacport/emacs-mac@30exp --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp 3 0%
#6,673 wgsl-analyzer 3 0%
#6,674 awsume 3 0%
#6,675 harmonybrew/core/r 3 0%
#6,676 littleclusters/tap/lc 3 0%
#6,677 smartbartdev/tap/ipb 3 0%
#6,678 newman 3 0%
#6,679 percona-server@8.4 3 0%
#6,680 gammaray 3 0%
#6,681 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,682 johnsideserf/siggy/siggy 3 0%
#6,683 roelofrossouw/sc/simply-cpp-image 3 0%
#6,684 bamin0422/tap/otpbar 3 0%
#6,685 ncpa 3 0%
#6,686 fio 3 0%
#6,687 dethok/tap/tokenburn 3 0%
#6,688 jq --HEAD 3 0%
#6,689 block-goose-cli --HEAD 3 0%
#6,690 vishalveerareddy123/lynkr/lynkr 3 0%
#6,691 ext2fuse 3 0%
#6,692 fortrangoingonforty/tap/ftop 3 0%
#6,693 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 3 0%
#6,694 tscriptify 3 0%
#6,695 lld --HEAD 3 0%
#6,696 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jpeg-xl --with-libbluray --with-libvmaf --with-openapv --with-webp 3 0%
#6,697 f-agnes/ffmpeg/ffmpeg@8 3 0%
#6,698 dotslash 3 0%
#6,699 railwaycat/emacsmacport/emacs-mac@30exp --with-starter 3 0%
#6,700 vsearch 3 0%
#6,701 solc-select 3 0%
#6,702 harmonybrew/core/codewhale 3 0%
#6,703 joshdholtz/tap/simmer 3 0%
#6,704 zeromq 3 0%
#6,705 cycode --HEAD 3 0%
#6,706 notunrandom/cardano/kupo 3 0%
#6,707 justadityaraj/tap/folderglass 3 0%
#6,708 opusfile 3 0%
#6,709 thegeeklab/tap/git-sv 3 0%
#6,710 stormchecker/stormchecker/stormchecker 3 0%
#6,711 kopia 3 0%
#6,712 getxbook 3 0%
#6,713 mist-cli --HEAD 3 0%
#6,714 ric3 3 0%
#6,715 vis --HEAD 3 0%
#6,716 libmediainfo 3 0%
#6,717 usexfg/tap/xfg 3 0%
#6,718 rizin --HEAD 3 0%
#6,719 eightyeighteyes/tune-shifter/tune-shifter 3 0%
#6,720 hahwul/cjules/cjules 3 0%
#6,721 tuguberk/napwatch/napwatch 3 0%
#6,722 vulkan-loader --HEAD 3 0%
#6,723 cargo-dist 3 0%
#6,724 cwensel/arcaneum/arcaneum 3 0%
#6,725 sontek/snowmachine/snowmachine 3 0%
#6,726 evoost-ai-gov/dmt/dmt 3 0%
#6,727 mybochs 3 0%
#6,728 lastarla/tap/bookkeeping-tool 3 0%
#6,729 aconchillo/guile/guile-lib 3 0%
#6,730 stricaud/tap/gtcaca 3 0%
#6,731 riomyers/sigil/sigil-cli 3 0%
#6,732 joshavant/tap/clawbox --HEAD 3 0%
#6,733 roberdan/convergio-cli/convergio 3 0%
#6,734 internetarchive 3 0%
#6,735 sox_ng --HEAD 3 0%
#6,736 harmonybrew/core/coreutils 3 0%
#6,737 plasma-umass/scalene/scalene 3 0%
#6,738 dgarnier/plasma/hdf5-udf 3 0%
#6,739 kikuchitomo/termojinal/termojinal 3 0%
#6,740 navanchauhan/tap/autodock-vina 3 0%
#6,741 msolve 3 0%
#6,742 socktainer 3 0%
#6,743 kangleon/tap/mellowclean 3 0%
#6,744 odin --HEAD 3 0%
#6,745 scala 2 0%
#6,746 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-crash-debug --with-imagemagick --with-modern-icon-savchenkovaleriy-3d-curvy --with-native-comp --with-no-frame-refocus --with-tree-sitter --with-xwidgets 2 0%
#6,747 raoulschaffner/tap/mtn 2 0%
#6,748 a52dec 2 0%
#6,749 sidneys/homebrew/rlottie 2 0%
#6,750 proxelar 2 0%
#6,751 ublue-os/experimental-tap/buildbox 2 0%
#6,752 tornikegomareli/swiftlings/swiftlings 2 0%
#6,753 homebrew-ffmpeg/ffmpeg/ffmpeg --with-game-music-emu --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-librsvg --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#6,754 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-imagemagick --with-mailutils --with-modern-doom3-icon --with-xwidgets 2 0%
#6,755 xyzhao1999/custom/tracy-dev 2 0%
#6,756 burakgon/roamcode/roamcode 2 0%
#6,757 hiasinho/tap/hammertalk 2 0%
#6,758 kyua 2 0%
#6,759 jonaburg/tmux-animated/tmux-animated 2 0%
#6,760 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libaribb24 --with-libaribcaption --with-webp 2 0%
#6,761 intelli-shell 2 0%
#6,762 paulafahmy-t/tools/aws-token-refresher 2 0%
#6,763 kahip/kahip/streamcpi 2 0%
#6,764 yoonhogo/tap/keyouse 2 0%
#6,765 glezseoane/tap/folstamp 2 0%
#6,766 jereok91/rustdiff/rustdiff 2 0%
#6,767 kost/ulx3s/project-trellis --HEAD 2 0%
#6,768 etanhey/layers/cmuxlayer 2 0%
#6,769 deungjaho/hydra/hydra 2 0%
#6,770 draftbrew/tap/hping 2 0%
#6,771 tproxy 2 0%
#6,772 rustpython 2 0%
#6,773 draftbrew/tap/shaka-packager 2 0%
#6,774 salvoclemenza-hub/vokari/vokari 2 0%
#6,775 drpedapati/tools/phi-cleaner 2 0%
#6,776 prrte 2 0%
#6,777 mxllmann/tap/batcycle 2 0%
#6,778 unar --HEAD 2 0%
#6,779 x86_64-elf-binutils 2 0%
#6,780 wallpaper 2 0%
#6,781 alhadis/troff/man-db 2 0%
#6,782 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#6,783 z80oolong/vte/roxterm 2 0%
#6,784 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --with-natural-title-bar --with-starter 2 0%
#6,785 kulturban/supernote-obsidian-sync/supernote-obsidian-sync 2 0%
#6,786 hafifuyku/putio-tui/putio-tui 2 0%
#6,787 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#6,788 libcaca 2 0%
#6,789 brndnsvr/tap/sysm 2 0%
#6,790 klirix/tap/albedo --HEAD 2 0%
#6,791 chenrui333/tap/bomtique 2 0%
#6,792 harmonybrew/core/fd 2 0%
#6,793 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-native-comp --with-tree-sitter --without-libxml2 2 0%
#6,794 purescript 2 0%
#6,795 blok-intelligence/tap/seldon 2 0%
#6,796 bazelbuild/tap/bazel@9.1.1 2 0%
#6,797 clintoncodewell/tap/cat-eye 2 0%
#6,798 tabiew 2 0%
#6,799 lukhasai/tap/lukhas 2 0%
#6,800 harmonybrew/core/libextractor 2 0%
#6,801 sqitchers/sqitch/sqitch --with-postgres-support --with-std-env 2 0%
#6,802 libwebsockets --HEAD 2 0%
#6,803 iptables 2 0%
#6,804 ensembl/external/mcl 2 0%
#6,805 jasper 2 0%
#6,806 jtianling/tap/dual-yazi 2 0%
#6,807 hlrs-vis/tap/visionaray 2 0%
#6,808 freetube 2 0%
#6,809 qwt 2 0%
#6,810 paneru 2 0%
#6,811 harmonybrew/core/proot 2 0%
#6,812 brewsci/bio/express 2 0%
#6,813 seatedro/glimpse/glimpse 2 0%
#6,814 liboqs 2 0%
#6,815 benswift/tap/cyrus-sasl-xoauth2 2 0%
#6,816 fast-cli 2 0%
#6,817 qobine-web 2 0%
#6,818 majiayu000/tap/ccstats 2 0%
#6,819 ruimachado-orbit/axeng/axeng 2 0%
#6,820 osx-cross/avr/avr-gcc@12 2 0%
#6,821 mrbogomips/tap/kb-fx 2 0%
#6,822 zerote/z9s/z9s 2 0%
#6,823 lucydodo/tap/sqlb-qt@5 2 0%
#6,824 ataraxy-labs/tap/inspect --HEAD 2 0%
#6,825 tschoonj/tap/easyrng 2 0%
#6,826 netwatch 2 0%
#6,827 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#6,828 lucidsleeping/mpegtic/mpegtic 2 0%
#6,829 grace 2 0%
#6,830 philippbogdan/tap/amail 2 0%
#6,831 harmonybrew/core/tectonic 2 0%
#6,832 zhovner/proxmark3/proxmark3 2 0%
#6,833 oxigraph/oxigraph/oxigraph 2 0%
#6,834 sjzar/tap/ips 2 0%
#6,835 railwaycat/emacsmacport/emacs-mac@29 --with-modern-icon --with-native-compilation --with-natural-title-bar --with-starter 2 0%
#6,836 git-jiro/jiro/gridcoin 2 0%
#6,837 ingmarstein/paperless-ngx/scikit-learn 2 0%
#6,838 btbutts/oxvelte/oxvelte --HEAD 2 0%
#6,839 av1an 2 0%
#6,840 takesako/sigrok/libsigrok --HEAD 2 0%
#6,841 truefrontier/tap/webcli 2 0%
#6,842 qtwebview 2 0%
#6,843 watch --HEAD 2 0%
#6,844 ailabstw/ceph-fuse/ceph-fuse 2 0%
#6,845 outscale/tap/frieza 2 0%
#6,846 hyano/sigrok/libsigrokdecode --HEAD 2 0%
#6,847 rustnet 2 0%
#6,848 estevesjh/mcp/mcp-ads-arxiv 2 0%
#6,849 pw4ever/zathura/zathura --HEAD 2 0%
#6,850 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-native-compilation --with-unlimited-select --with-xwidgets 2 0%
#6,851 jscpd 2 0%
#6,852 terracognita 2 0%
#6,853 git-pages 2 0%
#6,854 scaryrawr/formulae/sl 2 0%
#6,855 rustqc 2 0%
#6,856 openkj/openkj/openkj-unstable --HEAD 2 0%
#6,857 aker-dev/tap/microfolio 2 0%
#6,858 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-native-comp --with-native-full-aot --with-xwidgets 2 0%
#6,859 craigjmidwinter/tap/getvect 2 0%
#6,860 brewsci/science/hdf4 2 0%
#6,861 rdap 2 0%
#6,862 lifepillar/appleii/openemulator 2 0%
#6,863 libidn 2 0%
#6,864 photo-cli/photo-cli/photo-cli 2 0%
#6,865 brewsci/bio/psdm 2 0%
#6,866 badouralix/tap/rocksdb@8.10.0 2 0%
#6,867 sidneys/homebrew/chntpw --HEAD 2 0%
#6,868 shivammathur/extensions/gearman@8.6 2 0%
#6,869 shivammathur/extensions/grpc@8.6 2 0%
#6,870 wireshark --HEAD 2 0%
#6,871 sagernet/sing-box/sing-box@1.10.0 2 0%
#6,872 taosdata/tdengine/tdengine 2 0%
#6,873 libpostal 2 0%
#6,874 shigechika/tap/mcp-stdio 2 0%
#6,875 argtable 2 0%
#6,876 c0rmac/riemannian-gaussian-sampler/riemannian-gaussian-sampler-mlx 2 0%
#6,877 yaws 2 0%
#6,878 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#6,879 dlr-ts/sumo/sumo@1.15.0 2 0%
#6,880 apache-arrow-adbc 2 0%
#6,881 taylorfinklea/tap/spotlight-caffeinate-cli 2 0%
#6,882 osrf/simulation/gz-cmake5 2 0%
#6,883 shivammathur/php/php@7.4-debug 2 0%
#6,884 wired/tap/claude-spaces 2 0%
#6,885 thibaultlefort/allegro4/allegro4 2 0%
#6,886 theo-dunamu/litellm-notch/litellm-notch 2 0%
#6,887 mschulkind-oss/tap/tillr 2 0%
#6,888 oops-rs/tap/grapha 2 0%
#6,889 freecad/freecad/numpy@2.1.1_py312 2 0%
#6,890 oleghq/agentpack/agentpack 2 0%
#6,891 2mawi2/tap/para 2 0%
#6,892 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-imagemagick --with-librsvg 2 0%
#6,893 n8n-io/n8n/n8n 2 0%
#6,894 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-imagemagick --with-mailutils --with-modern-doom3-icon --with-xwidgets 2 0%
#6,895 tlsx 2 0%
#6,896 hboon/tap/shotpath 2 0%
#6,897 vladistan/gizmos/crystalia-collector 2 0%
#6,898 mame --HEAD 2 0%
#6,899 directgate/directgate/directgate 2 0%
#6,900 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-zimg 2 0%
#6,901 jasonvassallo/tap/mlx-audiogen --with-llm 2 0%
#6,902 cloud-native-toolkit/techzone/itz 2 0%
#6,903 zerob13/tap/vibe-hauler 2 0%
#6,904 kahip/kahip/fpt-max-cut 2 0%
#6,905 libbluray 2 0%
#6,906 danieljustus/tap/symeraseme 2 0%
#6,907 fintoc-com/tap/fintoc 2 0%
#6,908 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libplacebo --with-zimg 2 0%
#6,909 clarkfannin/duel/duel 2 0%
#6,910 0xlxx/tap/bitwarden-backup 2 0%
#6,911 d12frosted/emacs-plus/emacs-plus@30 --with-modern-papirus-icon --with-xwidgets 2 0%
#6,912 sourcery 2 0%
#6,913 ssulser/local/gnucobol33 2 0%
#6,914 avalan-ai/avalan/avalan 2 0%
#6,915 cgal 2 0%
#6,916 logdy 2 0%
#6,917 nrsc5 --HEAD 2 0%
#6,918 brewsci/bio/sumaclust 2 0%
#6,919 lifepillar/appleii/unlatch 2 0%
#6,920 mapillary_tools 2 0%
#6,921 sensecherise/tap/token-spendie 2 0%
#6,922 fortune 2 0%
#6,923 williamhcarter/zfetch/zfetch 2 0%
#6,924 dreal/dreal/dreal 2 0%
#6,925 codedeviate/cli/recon-impersonate 2 0%
#6,926 jordanbaird/createicns/createicns 2 0%
#6,927 ubertooth 2 0%
#6,928 allenbina/tap/chatwire --HEAD 2 0%
#6,929 hmerritt/tap/explorer 2 0%
#6,930 edwmurph/tap/weft 2 0%
#6,931 datasette 2 0%
#6,932 tarantool 2 0%
#6,933 d12frosted/emacs-plus/emacs-plus@31 --with-dragon-icon 2 0%
#6,934 dgarnier/plasma/metis@5.2 2 0%
#6,935 shivammathur/extensions/swoole@8.2 2 0%
#6,936 rpl 2 0%
#6,937 nnutter/tap/git-wt 2 0%
#6,938 d12frosted/emacs-plus/emacs-plus@32 --with-compress-install --with-dbus --with-xwidgets 2 0%
#6,939 dehautenbas/therion/therion 2 0%
#6,940 pympress 2 0%
#6,941 demola234/tap/flutter_bunny 2 0%
#6,942 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-decklink 2 0%
#6,943 d12frosted/emacs-plus/emacs-plus@30 --with-elrumo2-icon --with-imagemagick --with-mailutils --with-xwidgets 2 0%
#6,944 freerdp --HEAD 2 0%
#6,945 vfkit --HEAD 2 0%
#6,946 girara 2 0%
#6,947 ivorpad/tap/sxr 2 0%
#6,948 homebrew-zathura/zathura/zathura --HEAD --with-no-titlebar --with-synctex 2 0%
#6,949 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#6,950 10000doo/discord-agent-bridge/dab 2 0%
#6,951 netfetch 2 0%
#6,952 d12frosted/emacs-plus/emacs-plus@32 --with-mailutils 2 0%
#6,953 d12frosted/emacs-plus/emacs-plus@29 --with-ctags --with-debug --with-imagemagick --with-native-comp 2 0%
#6,954 jpetsis/tap/libsnobol4 2 0%
#6,955 9zax/tap/aeasy-display 2 0%
#6,956 ebuntario/munchfile/munchfile 2 0%
#6,957 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#6,958 shapelayer/tap/namumark 2 0%
#6,959 denji/nginx/nginx-full --with-xsltproc-module 2 0%
#6,960 prog893/tap/materialize 2 0%
#6,961 thecontinium/tap/litellm 2 0%
#6,962 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#6,963 lcyluke/apex/apex 2 0%
#6,964 task --HEAD 2 0%
#6,965 arthurcolle/tap/dsco 2 0%
#6,966 fluid-synth --HEAD 2 0%
#6,967 ocm 2 0%
#6,968 gitnr 2 0%
#6,969 rene-dev/sigrok/pulseview --HEAD 2 0%
#6,970 ants 2 0%
#6,971 debrosdao/tap/rootwallet 2 0%
#6,972 bind --HEAD 2 0%
#6,973 cargo-shear 2 0%
#6,974 llvm-hs/llvm/llvm-10 2 0%
#6,975 d12frosted/emacs-plus/emacs-plus@31 --with-retro-gnu-meditate-levitate-icon --with-xwidgets 2 0%
#6,976 libass --HEAD 2 0%
#6,977 frank-bot07/usrcp/usrcp 2 0%
#6,978 rockorager/tap/zigdoc 2 0%
#6,979 swiftly --HEAD 2 0%
#6,980 tholu/tap/subversion18 2 0%
#6,981 tkersey/tap/kotlin-debug-adapter 2 0%
#6,982 hf --HEAD 2 0%
#6,983 grafana/grafana/agento11y 2 0%
#6,984 grafana --HEAD 2 0%
#6,985 felixkratz/formulae/svim --HEAD 2 0%
#6,986 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-natural-title-bar --with-starter 2 0%
#6,987 synergy-core 2 0%
#6,988 signalwire/signalwire/sofia-sip 2 0%
#6,989 recmanj-org/ecmwf/odc 2 0%
#6,990 idleberg/nsisbi/nsisbi@3.06.1.3 2 0%
#6,991 shivammathur/extensions/protobuf@8.0 2 0%
#6,992 fetch 2 0%
#6,993 gomplate 2 0%
#6,994 yancya/reminder-cli/reminder-cli 2 0%
#6,995 sharpedgemarshall/homebrew/pulumi-tui 2 0%
#6,996 guitorri/tap/asco 2 0%
#6,997 wmbusmeters 2 0%
#6,998 barbich/contrib/phockup 2 0%
#6,999 flimble/tap/agent-mutator 2 0%
#7,000 twam/openfpga/nextpnr --HEAD --without-arch-ice40 --without-arch-nexus --without-python 2 0%
#7,001 librealsense --HEAD 2 0%
#7,002 jbigkit 2 0%
#7,003 fltk 2 0%
#7,004 paps 2 0%
#7,005 autobrew/cran/libgit2-macos 2 0%
#7,006 guoxbin/guoxbin/dtool 2 0%
#7,007 goclone 2 0%
#7,008 libsass --HEAD 2 0%
#7,009 steipete/tap/gifgrep 2 0%
#7,010 alyraffauf/tap/tg 2 0%
#7,011 everlof/tap/claudex 2 0%
#7,012 byronxlg/tap/polymarket-tui 2 0%
#7,013 benmoose/cli-utils/cli-utils 2 0%
#7,014 david-truong/liferay/gw 2 0%
#7,015 hawkeye 2 0%
#7,016 vermin 2 0%
#7,017 atomgit-cli 2 0%
#7,018 brewsci/num/brewsci-superlu 2 0%
#7,019 neteinstein/tap/calendar-sync 2 0%
#7,020 tflint --HEAD 2 0%
#7,021 usgerman-keyboard-layout 2 0%
#7,022 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-spacemacs-icon 2 0%
#7,023 scalapack 2 0%
#7,024 microsoft/mssql-release/msodbcsql18 --without-registration 2 0%
#7,025 shivammathur/extensions/swoole@8.1 2 0%
#7,026 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-cairo --with-chromaprint --with-decklink --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,027 daviderestivo/fortune-mod/fortune-mod --with-fortune-mod-it --with-fortune-mod-woody-allen-it --with-offensive 2 0%
#7,028 mactop --HEAD 2 0%
#7,029 orkward/tap/oama 2 0%
#7,030 cargo-binstall 2 0%
#7,031 eblot/riscvelf/riscv-elf-newlib 2 0%
#7,032 lore 2 0%
#7,033 onednn 2 0%
#7,034 leung-kam-ho/socattui/socattui 2 0%
#7,035 k0sproject/tap/k0sctl 2 0%
#7,036 david0/audio/swh-lv2 2 0%
#7,037 brewsci/bio/flye 2 0%
#7,038 f2 2 0%
#7,039 trud-rakva/repo/lrzsz 2 0%
#7,040 hawkw/grub/grub 2 0%
#7,041 daviderestivo/emacs-head/emacs-head@26 2 0%
#7,042 d12frosted/emacs-plus/emacs-plus@28 --with-ctags --with-native-comp 2 0%
#7,043 d12frosted/emacs-plus/emacs-plus@29 --with-modern-icon 2 0%
#7,044 generald/tap/lyra 2 0%
#7,045 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-imagemagick --without-libxml2 2 0%
#7,046 aflow-org/aflow/aflow 2 0%
#7,047 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-libvmaf 2 0%
#7,048 aryamanw/pastetrail/pastetrail 2 0%
#7,049 leetcode-cli 2 0%
#7,050 joshuabryson/tap/eq-reference-mcp 2 0%
#7,051 autumngarage/conductor/conductor --without-claude --without-codex 2 0%
#7,052 maxim-belkin/xorg/xclock 2 0%
#7,053 daavid00/opm/type-lite 2 0%
#7,054 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-starter 2 0%
#7,055 omrikais/duplicates-detector/duplicates-detector 2 0%
#7,056 micropython 2 0%
#7,057 d12frosted/emacs-plus/emacs-plus@30 --with-modern-paper-icon 2 0%
#7,058 eugot/tap/gitstore --HEAD 2 0%
#7,059 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-mac-metal --with-modern-icon --with-native-comp --with-natural-title-bar 2 0%
#7,060 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-imagemagick --with-memeplex-slim-icon 2 0%
#7,061 cdinnison/ascii-tee/ascii-tee 2 0%
#7,062 arushs/tap/aimeter 2 0%
#7,063 tulilirockz/bcvk/bcvk 2 0%
#7,064 clasp-developers/clasp/cando 2 0%
#7,065 rigellute/tap/spotify-tui 2 0%
#7,066 thorvg 2 0%
#7,067 ncar/lrose/lrose-vortrac 2 0%
#7,068 microsoft/mssql-release/msodbcsql17@17.11.1.1 2 0%
#7,069 chrome-cli --HEAD 2 0%
#7,070 gromgit/tap/ffmpeg-cuda 2 0%
#7,071 elmercsc/elmerfem/elmer --HEAD --without-mumps --without-open-mpi 2 0%
#7,072 elmercsc/elmerfem/elmer --without-hypre --without-mumps 2 0%
#7,073 gromgit/fuse/rclone-mac 2 0%
#7,074 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-sexy-icon 2 0%
#7,075 kabel/pecl/php@8.3-mailparse 2 0%
#7,076 darconeous/embedded/cc-tool 2 0%
#7,077 rypen/cli-tools/git-branch-day 2 0%
#7,078 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-no-frame-refocus --with-xwidgets 2 0%
#7,079 lgarron/lgarron/rmtag --HEAD 2 0%
#7,080 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-librist --with-openh264 --with-openssl --with-rav1e --with-rtmpdump --with-srt --with-tesseract 2 0%
#7,081 bl4cc4t/vsplugins/vsp-bm3d 2 0%
#7,082 lgarron/lgarron/dmgify --HEAD 2 0%
#7,083 lazyjournal 2 0%
#7,084 nixberg/tap/genpass --HEAD 2 0%
#7,085 wtfutil 2 0%
#7,086 mustache 2 0%
#7,087 lucataco/tap/kokoro-cli 2 0%
#7,088 clojure/tools/clojure 2 0%
#7,089 zmap 2 0%
#7,090 sourceos-linux/tap/noetica 2 0%
#7,091 revelo 2 0%
#7,092 crosstool-ng --HEAD 2 0%
#7,093 apibuilder-cli 2 0%
#7,094 undercover 2 0%
#7,095 reneboygarcia/tap/webp-converter 2 0%
#7,096 bigbes/tap/trusttunnel 2 0%
#7,097 lgarron/lgarron/thirdparty-demucs --HEAD 2 0%
#7,098 lgarron/lgarron/avif --HEAD 2 0%
#7,099 jahirvidrio/tap/critique 2 0%
#7,100 openssl 2 0%
#7,101 purplesquirrelmedia/coldstar/coldstar 2 0%
#7,102 dericed/nmaahcmm/mkvnote 2 0%
#7,103 ataraxy-labs/tap/inspect 2 0%
#7,104 osrf/simulation/ignition-launch5 2 0%
#7,105 harmonybrew/core/gnutls 2 0%
#7,106 dakra/tap/elate 2 0%
#7,107 teku 2 0%
#7,108 bear10591/tap/arib2bdnxml 2 0%
#7,109 thriftgo 2 0%
#7,110 avibrahms/tap/system-zero 2 0%
#7,111 sdl12-compat 2 0%
#7,112 sujankapadia/claude-code-analytics/claude-code-analytics 2 0%
#7,113 cargo-update 2 0%
#7,114 posh 2 0%
#7,115 shivammathur/extensions/ast@8.5 2 0%
#7,116 pkgx 2 0%
#7,117 iyadhkhalfallah/clauditor/clauditor 2 0%
#7,118 tholu/tap/arpwatch 2 0%
#7,119 acourtneybrown/tap/zapp 2 0%
#7,120 pipxu 2 0%
#7,121 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-natural-title-bar 2 0%
#7,122 david0/audio/blop-lv2 2 0%
#7,123 bullet 2 0%
#7,124 zyedidia/literate/literate --HEAD 2 0%
#7,125 cloud-v/icestorm/icestorm 2 0%
#7,126 anvera/tsl-extract/tsl-extract 2 0%
#7,127 takesako/sigrok/sigrok-firmware-fx2lafw --HEAD 2 0%
#7,128 kabel/pecl/php@8.3-apcu 2 0%
#7,129 gmic 2 0%
#7,130 sethvoltz/friday/friday 2 0%
#7,131 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-imagemagick --with-savchenkovaleriy-big-sur-icon --with-xwidgets 2 0%
#7,132 git-branchless 2 0%
#7,133 gomi 2 0%
#7,134 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-modern-icon-elrumo2 --with-native-full-aot --with-tree-sitter --with-xwidgets 2 0%
#7,135 d12frosted/emacs-plus/emacs-plus@32 --with-mailutils --with-xwidgets 2 0%
#7,136 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-native-comp 2 0%
#7,137 black-sat/black/black-sat 2 0%
#7,138 libnfc --HEAD 2 0%
#7,139 jguida941/codex-voice/codex-voice 2 0%
#7,140 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-tree-sitter 2 0%
#7,141 shivammathur/extensions/pdo_firebird@8.3 2 0%
#7,142 gcc --with-postgres-support 2 0%
#7,143 crodorg/fuga/fuga 2 0%
#7,144 pidgin --HEAD 2 0%
#7,145 harmonybrew/core/yasm 2 0%
#7,146 simpleaf 2 0%
#7,147 or-tools@9.8 2 0%
#7,148 osrf/simulation/ignition-msgs5 --HEAD 2 0%
#7,149 wvteijlingen/tap/swift-bsp 2 0%
#7,150 o6uoq/tap/toad 2 0%
#7,151 mdev-linux/tap/gtkwave --HEAD 2 0%
#7,152 tpatrouillat/tap/tokease 2 0%
#7,153 duo121/claude-session-fork/claude-session-fork 2 0%
#7,154 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-icon --with-modern-papirus-icon 2 0%
#7,155 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,156 dotkeeper 2 0%
#7,157 motif 2 0%
#7,158 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-srt --with-webp 2 0%
#7,159 nethermindeth/nethermind/nethermind 2 0%
#7,160 rioriost/macocr/macocr 2 0%
#7,161 liangzhiyu/xcodex/xcodex 2 0%
#7,162 gfargo/localpress/localpress 2 0%
#7,163 committed 2 0%
#7,164 ideademic/tap/aseprite 2 0%
#7,165 juicefs 2 0%
#7,166 bitmap4/tap/ds4color 2 0%
#7,167 xafloc/noteflow/noteflow-py 2 0%
#7,168 andyrewlee/amux/amux 2 0%
#7,169 fastfetch --HEAD 2 0%
#7,170 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,171 openrtm/openrtm2/openrtm2-python-py310 2 0%
#7,172 jansson 2 0%
#7,173 flex --HEAD 2 0%
#7,174 huaium/tap/cockup 2 0%
#7,175 smillerdev/tap/php-uopz 2 0%
#7,176 anirbanbasu/tap/odir 2 0%
#7,177 dilumaluthge/tap/pijul@0.15 2 0%
#7,178 shivammathur/extensions/pdo_firebird@7.1 2 0%
#7,179 shivammathur/php/php@7.1-debug-zts 2 0%
#7,180 abinit/tap/netcdf-fortran-parallel 2 0%
#7,181 shivammathur/extensions/pdo_firebird@7.2 2 0%
#7,182 vinn-ie/openems/openems 2 0%
#7,183 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-dvd --with-jpeg-xl --with-rav1e --with-srt --with-webp --with-xvid 2 0%
#7,184 shivammathur/extensions/pdo_firebird@8.0 2 0%
#7,185 ansible-cmdb 2 0%
#7,186 stikypiston/formulae/bobafm 2 0%
#7,187 athal7/tap/ocdc 2 0%
#7,188 linuxbrew/xorg/libglvnd 2 0%
#7,189 bugsterapp/tap/bugster 2 0%
#7,190 theapplegates/kleopatra6mac/kf6-kservice 2 0%
#7,191 bendews/core/apw 2 0%
#7,192 log4cpp 2 0%
#7,193 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --without-tree-sitter 2 0%
#7,194 adplay 2 0%
#7,195 brianjfox/tools/gnash 2 0%
#7,196 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-no-title-bars --with-starter --with-unlimited-select --with-xwidgets 2 0%
#7,197 aaratha/emacs-plus/emacs-plus@30 --with-modern-alecive-flatwoken-icon --with-native-comp --with-xwidgets 2 0%
#7,198 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-native-comp 2 0%
#7,199 rcmdnk/rcmdnkpac/screenutf8 2 0%
#7,200 fortrangoingonforty/ferp/ferp 2 0%
#7,201 runbear-io/autobrain/autobrain 2 0%
#7,202 ilpincy/argos3/argos3 --HEAD 2 0%
#7,203 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-modern-paper-icon 2 0%
#7,204 davep/homebrew/aging 2 0%
#7,205 signalwire/signalwire/libks2 2 0%
#7,206 svlang 2 0%
#7,207 clelange/particle-physics/cern-sso-cli 2 0%
#7,208 bengerthelorf/tap/bcmr 2 0%
#7,209 ie-developers/ie/gnuplot --without-lua 2 0%
#7,210 android-file-transfer-linux 2 0%
#7,211 danieljprice/all/giza-x11 2 0%
#7,212 amatsuzero/m3u8dl/n-m3u8dl-re 2 0%
#7,213 abhinavsns/openfpm/openfpm 2 0%
#7,214 alhadis/troff/heirloom-doctools 2 0%
#7,215 stepanhruda/tap/ios-simulator-app-installer 2 0%
#7,216 davidchall/hep/hepmc3 2 0%
#7,217 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,218 elmercsc/elmerfem/elmer --HEAD --with-elmergui 2 0%
#7,219 marksman --HEAD 2 0%
#7,220 datafruit-dev/lychee/lychee 2 0%
#7,221 httping --HEAD 2 0%
#7,222 aerc 2 0%
#7,223 willyv3/tap/slaygent-comms 2 0%
#7,224 tilt 2 0%
#7,225 jags 2 0%
#7,226 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-dvd --with-fdk-aac --with-jpeg-xl --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-openal-soft --with-openh264 --with-openjpeg --with-openssl --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid 2 0%
#7,227 d12frosted/emacs-plus/emacs-plus@30 --with-cacodemon-icon 2 0%
#7,228 osgeo/osgeo4mac/osgeo-libspatialite 2 0%
#7,229 rust-kotlin/taps/st 2 0%
#7,230 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-no-frame-refocus 2 0%
#7,231 amrkmn/tap/pv 2 0%
#7,232 bcg-doha/vpn-config/doha-vpn 2 0%
#7,233 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark --with-generic 2 0%
#7,234 bitrifttech/li/li 2 0%
#7,235 clopenset/harbour/karastat 2 0%
#7,236 macmade/tap/unicorn-bios --HEAD 2 0%
#7,237 nativefiledialog-extended 2 0%
#7,238 fastk 2 0%
#7,239 ralph 2 0%
#7,240 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-liquid-glass --with-native-comp --with-tree-sitter --with-xwidgets 2 0%
#7,241 inetutils 2 0%
#7,242 coder11v/tools/easydisk 2 0%
#7,243 xtool 2 0%
#7,244 mq 2 0%
#7,245 libsm 2 0%
#7,246 kubernetes-cli@1.32 2 0%
#7,247 julian/tap/ardour --HEAD 2 0%
#7,248 jimtcl 2 0%
#7,249 sidaf/pentest/libnl 2 0%
#7,250 isponsorblocktv 2 0%
#7,251 csfml 2 0%
#7,252 flow --HEAD 2 0%
#7,253 3000-2/tap/fid 2 0%
#7,254 cloudflare-speed-cli 2 0%
#7,255 shivammathur/php/php@7.4-zts 2 0%
#7,256 bazelbuild/tap/bazel@8.3.1 2 0%
#7,257 youtui 2 0%
#7,258 rockcarver/frodo-cli/frodo-cli-next 2 0%
#7,259 ncar/lrose/lrose-samurai 2 0%
#7,260 goailoop/cli/ailoop 2 0%
#7,261 hasura-cli 2 0%
#7,262 shivammathur/extensions/xdebug@8.3 2 0%
#7,263 marvin-klein/tap/loudgain 2 0%
#7,264 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac 2 0%
#7,265 shaka-packager --HEAD 2 0%
#7,266 tleepa/tap/az-pim-cli 2 0%
#7,267 asdf --HEAD 2 0%
#7,268 foscomputerservices/tap/hindsight-mcp 2 0%
#7,269 termframe 2 0%
#7,270 creduce 2 0%
#7,271 towardsthecloud/tap/cloudburn 2 0%
#7,272 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-imagemagick --with-librsvg --with-modern-icon --with-native-comp --with-xwidgets 2 0%
#7,273 zegervdv/zathura/girara 2 0%
#7,274 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-imagemagick 2 0%
#7,275 harper 2 0%
#7,276 afiller/pathmate/coreutils@9.0 2 0%
#7,277 dlr-ts/sumo/sumo --with-examples --with-ffmpeg --with-gdal --with-gl2ps --with-open-scene-graph --with-swig 2 0%
#7,278 daavid00/opm/dune-common 2 0%
#7,279 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,280 numpy --HEAD 2 0%
#7,281 ccusage 2 0%
#7,282 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-openmp --without-hypre --without-mumps 2 0%
#7,283 ochko/taps/emacs@29 2 0%
#7,284 sentencepiece 2 0%
#7,285 danpashin/repo/go --HEAD 2 0%
#7,286 alkautsarf/tap/blip --HEAD 2 0%
#7,287 nxtedition/libplacebo/libplacebo --HEAD 2 0%
#7,288 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-mailutils --with-xwidgets 2 0%
#7,289 librespot 2 0%
#7,290 units 2 0%
#7,291 graelo/tap/dvoratt 2 0%
#7,292 namore/custom/calculix-ccx 2 0%
#7,293 leftrk/tap/tmux-window-name 2 0%
#7,294 firefoxpwa --HEAD 2 0%
#7,295 odiff 2 0%
#7,296 celsiusnarhwal/htt/pekora 2 0%
#7,297 subliminal 2 0%
#7,298 shivammathur/extensions/pdo_firebird@5.6 2 0%
#7,299 shivammathur/extensions/pdo_firebird@7.4 2 0%
#7,300 mo-tenstorrent/tools/tracy-experimental --HEAD 2 0%
#7,301 pranav-karra-3301/lbxd/lbxd 2 0%
#7,302 freeradius-server --HEAD 2 0%
#7,303 konyu/kikitori/kikitori 2 0%
#7,304 coilysiren/tap/repo-recall 2 0%
#7,305 shivammathur/extensions/pdo_firebird@7.3 2 0%
#7,306 shivammathur/extensions/pdo_firebird@7.0 2 0%
#7,307 pnetcdf 2 0%
#7,308 kyoto-cabinet 2 0%
#7,309 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-srt 2 0%
#7,310 thefanatr/gtkwave/gtkwave --HEAD 2 0%
#7,311 ivoronin/ivoronin/coinbar 2 0%
#7,312 dinesh-git17/passfx/passfx 2 0%
#7,313 vaibhav-mattoo/alman/alman 2 0%
#7,314 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-jpeg-xl --with-libplacebo --with-librsvg 2 0%
#7,315 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libplacebo --with-libsoxr --with-libvmaf 2 0%
#7,316 stork-search/stork-tap/stork 2 0%
#7,317 krakend 2 0%
#7,318 nikhilch98/taskbrew/taskbrew 2 0%
#7,319 pratyay360/tap/toolbox-export 2 0%
#7,320 terraform-docs 2 0%
#7,321 akinoiro/tap/ssh-list 2 0%
#7,322 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libvmaf --with-rav1e --with-svt-av1 --with-zimg 2 0%
#7,323 uhubctl --HEAD 2 0%
#7,324 llvm-hs/llvm/llvm-8 2 0%
#7,325 sisoe24/timbre/timbre 2 0%
#7,326 iceberg-cli 2 0%
#7,327 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,328 brewsci/science/rna-star 2 0%
#7,329 marp-cli 2 0%
#7,330 zxuexingzhijie/tavern/tavern-game 2 0%
#7,331 helix-db 2 0%
#7,332 werf 2 0%
#7,333 pork0594/wizerd/wizerd 2 0%
#7,334 ricka7x/asset-forge/asset-forge 2 0%
#7,335 wossfoss/vapoursynth/vapoursynth-fpng 2 0%
#7,336 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-openjpeg --with-srt --with-webp --with-xvid 2 0%
#7,337 sheurich/tap/ingest 2 0%
#7,338 denji/nginx/nginx-full --with-addition --with-auth-pam-module --with-auth-req --with-dav-ext-module --with-debug --with-echo-module --with-gunzip --with-gzip-static --with-http2 --with-image-filter --with-mail --with-mail-ssl --with-pcre-jit --with-realip --with-slice --with-status --with-stream --with-stream-ssl --with-stream-ssl-preread --with-sub --with-subs-filter-module --with-webdav --with-xslt 2 0%
#7,339 fontconfig --HEAD 2 0%
#7,340 denji/nginx/nginx-full --with-dav-ext-module --with-webdav 2 0%
#7,341 georgemcarlson/svt-av1/svt-av1 2 0%
#7,342 liuyanwpuuci/aerospace/xfoil 2 0%
#7,343 wiggle 2 0%
#7,344 loveholidays/tap/dbt1 2 0%
#7,345 incus 2 0%
#7,346 mathobsession/tap/turbo-fieldfare 2 0%
#7,347 q00/tap/ouroboros-ai 2 0%
#7,348 reproc 2 0%
#7,349 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-xwidgets 2 0%
#7,350 rtk --HEAD 2 0%
#7,351 libcdio 2 0%
#7,352 chenxiaoyu233/tap/ai-chat-speed-booster 2 0%
#7,353 harmonybrew/core/clipper2 2 0%
#7,354 bundle-update-interactive 2 0%
#7,355 zint 2 0%
#7,356 libblastrampoline 2 0%
#7,357 cqj1558/usdzsimplify/usdzsimplify@1.0.0 2 0%
#7,358 tektoncd-cli 2 0%
#7,359 gsmartcontrol 2 0%
#7,360 cxwx/cxbrew/squawk 2 0%
#7,361 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#7,362 dynare 2 0%
#7,363 openfortivpn --HEAD 2 0%
#7,364 homebrew-ffmpeg/ffmpeg/ffmpeg --with-zeromq 2 0%
#7,365 yarn@4 2 0%
#7,366 learny-technologies/tap/controlpctl 2 0%
#7,367 infracost 2 0%
#7,368 phuongddx/spm-cache/spm-cache 2 0%
#7,369 detect-secrets 2 0%
#7,370 msuchane/repo/near-facsimile 2 0%
#7,371 keinobjekt/bcfeed/bcfeed 2 0%
#7,372 bramstein/webfonttools/ots 2 0%
#7,373 geographiclib 2 0%
#7,374 dandylyons/frontrange/frontrange 2 0%
#7,375 jkitchin/scimax/scimax --HEAD 2 0%
#7,376 musepack 2 0%
#7,377 skillspector 2 0%
#7,378 basis_universal 2 0%
#7,379 libusb-compat 2 0%
#7,380 librespeed/tap/librespeed-cli --HEAD 2 0%
#7,381 kind --HEAD 2 0%
#7,382 alexkli/tap/wrk2 --HEAD 2 0%
#7,383 bigbrainafk/test/wine-crossover 2 0%
#7,384 gromgit/tap/mcdu 2 0%
#7,385 rweir/tap/imapgoose 2 0%
#7,386 findutils 2 0%
#7,387 ncmpcpp 2 0%
#7,388 dlr-ts/sumo/sumo@1.9.2 2 0%
#7,389 aarch64-elf-gdb 2 0%
#7,390 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-dbus --with-imagemagick --with-mailutils --with-no-frame-refocus --with-xwidgets 2 0%
#7,391 zachlatta/gitignorer/gitignorer 2 0%
#7,392 bigcommerce/choria/choria 2 0%
#7,393 adnichols/ttrans/ttrans 2 0%
#7,394 ktemkin/oss-fpga/icestorm --HEAD 2 0%
#7,395 ghz-web 2 0%
#7,396 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libcaca --with-libdvdnav --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openjpeg --with-rtmpdump --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-webp --with-xvid --with-zimg 2 0%
#7,397 daviderestivo/emacs-head/emacs-head@30 --HEAD --with-native-comp --with-native-full-aot --with-tree-sitter 2 0%
#7,398 flecs 2 0%
#7,399 rfidresearchgroup/proxmark3/proxmark3 --with-flash 2 0%
#7,400 stellar-cli 2 0%
#7,401 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-glib --with-imagemagick --with-mac-metal --with-native-comp --with-natural-title-bar --with-starter --with-xwidgets --without-modules 2 0%
#7,402 d12frosted/emacs-plus/emacs-plus@29 --with-no-frame-refocus 2 0%
#7,403 basicmachines-co/basic-memory/basic-memory --HEAD 2 0%
#7,404 filosottile/musl-cross/musl-cross --with-powerpc64le 2 0%
#7,405 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-native-compilation --with-no-title-bars --with-starter --with-unlimited-select --with-xwidgets 2 0%
#7,406 dlr-ts/sumo/sumo@1.6.0 2 0%
#7,407 px4/px4/fastrtps15 2 0%
#7,408 gnu-which 2 0%
#7,409 carrick-sh/carrick/carrick --HEAD 2 0%
#7,410 andrewesweet/spnego-proxy/spnego-proxy 2 0%
#7,411 jcable/dream/dream 2 0%
#7,412 nikto 2 0%
#7,413 ice --HEAD 2 0%
#7,414 dooit 2 0%
#7,415 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,416 sylvinus/tap/lima-sylvinus 2 0%
#7,417 cargo-crev 2 0%
#7,418 sparelab/tap/sparetree 2 0%
#7,419 harmonybrew/core/roxctl 2 0%
#7,420 dyx884877791/i386-jos-elf-gcc/x86_64-jos-elf-gcc 2 0%
#7,421 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-ctags --with-librsvg --with-native-compilation --with-natural-title-bar --with-starter 2 0%
#7,422 brewsci/bio/miniasm 2 0%
#7,423 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-doom-icon --with-xwidgets 2 0%
#7,424 delnegend/tap/artefact-cli 2 0%
#7,425 nextpnr-ice40 2 0%
#7,426 ada-h00k/signal-cli-qt/signal-cli-qt 2 0%
#7,427 abhidg/tap/isync 2 0%
#7,428 yasm --HEAD 2 0%
#7,429 yara-x 2 0%
#7,430 donald-jackson/olm/python-olm 2 0%
#7,431 dotemacs/emacs-plus/emacs-plus@31 --with-xwidgets 2 0%
#7,432 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-no-title-bars 2 0%
#7,433 dleutnant/swmm5/swmm5-engine 2 0%
#7,434 yoggy/oscpack/oscpack 2 0%
#7,435 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark --with-hf-legic 2 0%
#7,436 fahasch/formulae/hsbcl 2 0%
#7,437 aloth/tap/olcli 2 0%
#7,438 hlrs-vis/tap/vistle 2 0%
#7,439 harmonybrew/core/ncurses 2 0%
#7,440 mkhexgrid 2 0%
#7,441 o6uoq/tap/paperclip 2 0%
#7,442 jacksonfergusondev/tap/focal 2 0%
#7,443 prism-cli 2 0%
#7,444 urdfdom 2 0%
#7,445 amberframework/amber/amber 2 0%
#7,446 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,447 mosra/magnum/magnum-examples --HEAD 2 0%
#7,448 bobmatnyc/tools/claude-mpm 2 0%
#7,449 cartman-kai/thrift/thrift@0.21 2 0%
#7,450 alepalma91/iago/iago 2 0%
#7,451 trongnghia203/zsh-ai-cli/zsh-ai-cli 2 0%
#7,452 borgmatic 2 0%
#7,453 zvbi 2 0%
#7,454 basilisk-labs/tap/agentplane 2 0%
#7,455 cdavis-code/google-vision/vision 2 0%
#7,456 harmonybrew/core/bind 2 0%
#7,457 jsheffie/tap/spacemap 2 0%
#7,458 oleksandrchekhovskyi/hax/hax 2 0%
#7,459 miao-tech/tap/opentaion 2 0%
#7,460 vedanthvdev/tap/git-pulse 2 0%
#7,461 altimg/ybar/ybar 2 0%
#7,462 gdb --HEAD 2 0%
#7,463 browningluke/tap/mangathr 2 0%
#7,464 codex 2 0%
#7,465 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-glib --with-imagemagick --with-mac-metal --with-native-compilation --with-starter --with-xwidgets 2 0%
#7,466 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,467 gauthierkk/cmdloop/cmdloop 2 0%
#7,468 drpedapati/tools/tmux-flow 2 0%
#7,469 francis-xavier-code/gqy/gqy 2 0%
#7,470 shadyabhi/tap/lumesent 2 0%
#7,471 coretxinc/tap/coretx 2 0%
#7,472 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-libssh --with-libvidstab --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-tesseract --with-xvid 2 0%
#7,473 cmakelang --HEAD 2 0%
#7,474 d12frosted/emacs-plus/emacs-plus@32 --with-dbus --with-xwidgets 2 0%
#7,475 dshakes/tap/distil 2 0%
#7,476 manishsv/airos/airos-cli 2 0%
#7,477 xbunax/tap/agent-tmux-notify 2 0%
#7,478 granted 2 0%
#7,479 bpingris/tap/openclose 2 0%
#7,480 shivammathur/extensions/ds@7.3 2 0%
#7,481 platformio 2 0%
#7,482 optex 2 0%
#7,483 pmoust/audiorec/audiorec 2 0%
#7,484 nubaeon/tap/empirica 2 0%
#7,485 tomahawk-player/tomahawkqt5/qtkeychain 2 0%
#7,486 libks 2 0%
#7,487 portable-ruby --HEAD 2 0%
#7,488 libxc 2 0%
#7,489 attipaci/pub/xchange --with-doxygen 2 0%
#7,490 sshpass 2 0%
#7,491 audivir/repo/dfhash 2 0%
#7,492 dyx884877791/i386-jos-elf-gcc/glib-jos-2821 2 0%
#7,493 flatbuffers 2 0%
#7,494 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libheif --with-webp 2 0%
#7,495 azisk/reed/reed 2 0%
#7,496 whirlwindoflight/tap/hardware-vnc --HEAD 2 0%
#7,497 harmonybrew/core/portable-ruby 2 0%
#7,498 vibepod/vibepod/vibepod 2 0%
#7,499 freecad/freecad/freecad@1.1.1_py313_qt6 --HEAD 2 0%
#7,500 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#7,501 e24z/tap/needle --HEAD 2 0%
#7,502 clpeak 2 0%
#7,503 rnwolfe/tap/gfly 2 0%
#7,504 nsync 2 0%
#7,505 rakalex/mac-brightnessctl/mac-brightnessctl 2 0%
#7,506 khou/klair/klair 2 0%
#7,507 meshtastic/tap/meshtasticd 2 0%
#7,508 shivammathur/php/php@7.1-zts 2 0%
#7,509 shivammathur/php/php@7.0-debug-zts 2 0%
#7,510 popcornpalace/tap/yawsso 2 0%
#7,511 cpp-peglib 2 0%
#7,512 alex-yanchenko/tap/ccsearch 2 0%
#7,513 supabase --HEAD 2 0%
#7,514 alexapvl/mytime/mytime --HEAD 2 0%
#7,515 river 2 0%
#7,516 fredfrazao/mb-aws-helper/mb-aws-helper 2 0%
#7,517 erlang@28 2 0%
#7,518 harmonybrew/core/xmlto 2 0%
#7,519 railwaycat/emacsmacport/emacs-mac@30exp --with-native-comp --with-starter --with-unlimited-select 2 0%
#7,520 yurikoles/yurikoles/far2l --HEAD --with-python@3.13 --without-wxwidgets 2 0%
#7,521 kylefeng28/tap/rvvm --HEAD 2 0%
#7,522 tinc 2 0%
#7,523 albinotonnina/echos/echos 2 0%
#7,524 gyb 2 0%
#7,525 luxfi/tap/lux 2 0%
#7,526 firewalker06/tycho/tycho --HEAD 2 0%
#7,527 astyle 2 0%
#7,528 shawnz/printing/libcupsfilters 2 0%
#7,529 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-imagemagick --with-mailutils --with-xwidgets 2 0%
#7,530 mpop 2 0%
#7,531 codeburn 2 0%
#7,532 dgarnier/plasma/m3dc1-complex 2 0%
#7,533 gromgit/tap/mold-ai 2 0%
#7,534 wgzhao/tap/lingbox 2 0%
#7,535 0xlxx/tap/media-pause 2 0%
#7,536 gnu-smalltalk 2 0%
#7,537 darker 2 0%
#7,538 lsgo 2 0%
#7,539 yuvrajadhikari/oats/oats 2 0%
#7,540 hellices/korvid/korvid 2 0%
#7,541 tgragnato/tap/gotools 2 0%
#7,542 dirlens 2 0%
#7,543 dappermint/tap/mac-cleaner 2 0%
#7,544 konaito/tap/opttab 2 0%
#7,545 brewsci/base/boost-rstudio-server 2 0%
#7,546 brewsci/bio/e-mem 2 0%
#7,547 jfb3615/repo/spacetime 2 0%
#7,548 stonebuddha/formulae/z3@4.8.6 2 0%
#7,549 gcab 2 0%
#7,550 glibmm 2 0%
#7,551 libmysofa 2 0%
#7,552 autumnjolitz/tap/zope@211 2 0%
#7,553 parquet-cli 2 0%
#7,554 mise --HEAD 2 0%
#7,555 shenyangs/tap/guanlan 2 0%
#7,556 tomcat-native 2 0%
#7,557 reed-colloton/tap/prompt-injection-honeypot 2 0%
#7,558 wl-clipboard 2 0%
#7,559 proxytunnel 2 0%
#7,560 irrlicht 2 0%
#7,561 grimme-lab/qc/tblite 2 0%
#7,562 d12frosted/emacs-plus/emacs-plus@30 --HEAD --with-compress-install --with-dbus --with-imagemagick --with-mailutils 2 0%
#7,563 nanomsg 2 0%
#7,564 pothosware/pothos/pothosaudio 2 0%
#7,565 ffmpeg@8 2 0%
#7,566 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-ctags --with-dbus --with-debug --with-imagemagick --with-mailutils --with-xwidgets 2 0%
#7,567 pocketbase 2 0%
#7,568 oxlint 2 0%
#7,569 inshell-art/tap/me 2 0%
#7,570 tide-tools/tide/tide 2 0%
#7,571 lux --HEAD 2 0%
#7,572 bigcactuslabs/tap/dead-letter 2 0%
#7,573 jc 2 0%
#7,574 dcmtk 2 0%
#7,575 floresta 2 0%
#7,576 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-crash-debug --with-imagemagick --with-infinity-yak-onthewater --with-mps --with-native-comp --with-tree-sitter --with-xwidgets 2 0%
#7,577 jagoff/memo/mlx-memo 2 0%
#7,578 infatoshi/phonon/phonon 2 0%
#7,579 raeq/tap/ibook2epub 2 0%
#7,580 ethereum/ethereum/ethereum 2 0%
#7,581 shivammathur/extensions/redis@8.5 2 0%
#7,582 hirokib/tap/ahem 2 0%
#7,583 tueda/form/form@4.3.1 2 0%
#7,584 hypre --HEAD 2 0%
#7,585 scdoc 2 0%
#7,586 xiw/jos/i386-jos-elf-gcc 2 0%
#7,587 cbc 2 0%
#7,588 colemei/openwith/openwith 2 0%
#7,589 hyperkit 2 0%
#7,590 icecube/icecube/multinest 2 0%
#7,591 lanterndata/lantern/lantern 2 0%
#7,592 d12frosted/emacs-plus/emacs-plus@30 --with-modern-alecive-flatwoken-icon 2 0%
#7,593 or-tools --HEAD 2 0%
#7,594 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-native-comp --with-no-frame-refocus --with-xwidgets 2 0%
#7,595 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-debug --with-dragon-icon --with-imagemagick --with-xwidgets 2 0%
#7,596 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#7,597 d12frosted/emacs-plus/emacs-plus@30 --with-c9rgreen-sonoma-icon --with-xwidgets 2 0%
#7,598 mattjcoles/lgtmaybe/lgtmaybe 2 0%
#7,599 rsyslog 2 0%
#7,600 d12frosted/emacs-plus/emacs-plus@29 --with-elrumo2-icon --with-native-comp 2 0%
#7,601 na-trium-144/webcface/webcface@3 2 0%
#7,602 alanstefanov/termainer/termainer 2 0%
#7,603 ataka/formulae/ls2xs 2 0%
#7,604 annotsv 2 0%
#7,605 orocos-kdl 2 0%
#7,606 d12frosted/emacs-plus/emacs-plus@30 --with-x11 --without-cocoa 2 0%
#7,607 px4/px4/genromfs 2 0%
#7,608 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#7,609 libqalculate 2 0%
#7,610 discoteq/discoteq/flock 2 0%
#7,611 ghdl-llvm 2 0%
#7,612 certigo 2 0%
#7,613 edbfi/taps/fredtv 2 0%
#7,614 zegervdv/zathura/zathura --HEAD --with-no-titlebar --with-synctex 2 0%
#7,615 jussinokelainen/metsavaluaatio/metsavaluaatio 2 0%
#7,616 idleberg/nsisbi/nsisbi@3.04.2 2 0%
#7,617 ncmpcpp --HEAD 2 0%
#7,618 gource 2 0%
#7,619 difftastic 2 0%
#7,620 rocq-micromega-plugin 2 0%
#7,621 libmpc --HEAD 2 0%
#7,622 hugo --HEAD 2 0%
#7,623 bat --HEAD 2 0%
#7,624 ncmpc 2 0%
#7,625 z80oolong/eaw/rxvt-unicode@9.30 2 0%
#7,626 cminpack 2 0%
#7,627 sashkab/python/python@3.8 2 0%
#7,628 tamentis/core/sleepuntil 2 0%
#7,629 eso/pipelines/edps 2 0%
#7,630 ma-r-s/tap/vox-transcribe 2 0%
#7,631 zabbix-cli 2 0%
#7,632 azat-archive/chdig/chdig 2 0%
#7,633 s4l1hs/shadowstep/shadowstep 2 0%
#7,634 d12frosted/emacs-plus/emacs-plus@31 --with-modern-doom-icon 2 0%
#7,635 mustacheride/gnuradio/gnuradio 2 0%
#7,636 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-fdk-aac --with-libplacebo --with-libvmaf --with-openjpeg --with-tesseract --with-zimg 2 0%
#7,637 chris-colinsky/zorac/zorac 2 0%
#7,638 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-whisper-cpp 2 0%
#7,639 mateuszmikrut/tap/semtag 2 0%
#7,640 vladimirmikhailov/pgtreats/pg_dirtyread 2 0%
#7,641 slp/krun/krunkit 2 0%
#7,642 sl0p-foo/slosh/slosh 2 0%
#7,643 libmemcached-awesome 2 0%
#7,644 dub 2 0%
#7,645 js-recon/tap/js-recon-alpha 2 0%
#7,646 moves-rwth/storm/stormchecker --HEAD 2 0%
#7,647 vladistan/gizmos/elk-tool 2 0%
#7,648 dwdiff 2 0%
#7,649 mayankgujrathi/tap/vocoflow 2 0%
#7,650 happy-coder --HEAD 2 0%
#7,651 z80oolong/vte/geany --HEAD 2 0%
#7,652 badouralix/tap/rocksdb@6.20.3 2 0%
#7,653 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-starter --with-unlimited-select --with-xwidgets 2 0%
#7,654 jaybrown/cn/cn 2 0%
#7,655 cjdns 2 0%
#7,656 morpho-lang/morpho/morpho 2 0%
#7,657 mjr19-c2x/c2x/c2x 2 0%
#7,658 southpawriter02/git-chronoscope/git-chronoscope 2 0%
#7,659 libigloo 2 0%
#7,660 openemv/tap/emv-utils 2 0%
#7,661 nqptp 2 0%
#7,662 memcached 2 0%
#7,663 hokix/oldcmake/zbar@0.10 2 0%
#7,664 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-mailutils --with-xwidgets 2 0%
#7,665 osrf/simulation/ignition-common4 2 0%
#7,666 libmtp 2 0%
#7,667 page 2 0%
#7,668 duc 2 0%
#7,669 denji/nginx/nginx-full --with-eval-module --with-geoip2-module --with-http2 --with-http3 --with-image-filter --with-rtmp-module --with-slice --with-status --with-stream --with-stream-geoip --with-stream-ssl --with-stream-ssl-preread --with-unzip-module --with-upload-module --with-upload-progress-module --with-upstream-check-module --with-vod-module --with-websockify-module --with-xslt --with-xsltproc-module 2 0%
#7,670 denji/nginx/nginx-full --with-eval-module --with-geoip2-module --with-http2 --with-http3 --with-image-filter --with-rtmp-module --with-slice --with-status --with-stream --with-stream-ssl --with-stream-ssl-preread --with-unzip-module --with-upload-module --with-upstream-check-module --with-vod-module --with-websockify-module --with-xslt 2 0%
#7,671 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,672 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-librsvg --with-native-compilation --with-natural-title-bar --with-starter 2 0%
#7,673 xafloc/noteflow/noteflow 2 0%
#7,674 px4/px4/foonathan-memory 2 0%
#7,675 programmerin-wonderland/raff/kf5-kdoctools 2 0%
#7,676 talhelper 2 0%
#7,677 chrisjrex/vtt/vtt 2 0%
#7,678 kconf 2 0%
#7,679 uhd --HEAD 2 0%
#7,680 harmonybrew/core/rust 2 0%
#7,681 devthekiwi/claudepet/claudepet 2 0%
#7,682 johnhcc/gs-x11/gv 2 0%
#7,683 garble 2 0%
#7,684 moon 2 0%
#7,685 libxmlb 2 0%
#7,686 thehavays/tap/filegate 2 0%
#7,687 schollz/tap/collidertracker 2 0%
#7,688 shivammathur/extensions/v8js@8.3 2 0%
#7,689 hadesllm/morie/morie 2 0%
#7,690 fuse-ext2 2 0%
#7,691 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-mac-metal --with-native-compilation --with-unlimited-select --with-xwidgets --without-tree-sitter 2 0%
#7,692 geoffbelknap/tap/microagent-kit 2 0%
#7,693 beancount 2 0%
#7,694 mplayer --HEAD 2 0%
#7,695 mutagen-io/mutagen/mutagen-edge 2 0%
#7,696 aegiosot/ybar/ybar 2 0%
#7,697 memex 2 0%
#7,698 swtpm 2 0%
#7,699 macaulay2/tap/mpsolve 2 0%
#7,700 wesleyscholl/squish/squish 2 0%
#7,701 marvinhuelsmann/screenflow/screenflow 2 0%
#7,702 python-packaging 2 0%
#7,703 minorglitch/ethernity/ethernity 2 0%
#7,704 yamlfix 2 0%
#7,705 gnutls --HEAD 2 0%
#7,706 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-native-comp 2 0%
#7,707 libobjc2 2 0%
#7,708 finefindus/tap/artem 2 0%
#7,709 bl4cc4t/vsplugins/vsp-flash3kyuu_deband 2 0%
#7,710 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libaribb24 --with-libaribcaption --with-libxml2 --with-srt 2 0%
#7,711 killswitch 2 0%
#7,712 build-ai-ego/tap/buildai-cli 2 0%
#7,713 smoosex/tap/qwen-asr-cli 2 0%
#7,714 vkhitrin/tap/cosmic-icons-theme --HEAD 2 0%
#7,715 halbotley/tap/calmly 2 0%
#7,716 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install 2 0%
#7,717 macmon 2 0%
#7,718 idleberg/nsisbi/nsisbi@3.04.1 2 0%
#7,719 sk3pp3r/tap/ssh-mngr 2 0%
#7,720 mfbaig35r/lazydatabricks/lazydatabricks 2 0%
#7,721 osrf/simulation/gz-rotary --HEAD 2 0%
#7,722 gonzalofuentes28/tap/video-mosaic 2 0%
#7,723 andydixon/tap/apex 2 0%
#7,724 trtmn/tools/deck 2 0%
#7,725 steipete/tap/summarize 2 0%
#7,726 shivammathur/extensions/couchbase@8.5 2 0%
#7,727 germag/podman-bootc/podman-bootc 2 0%
#7,728 shivammathur/extensions/ds@8.0 2 0%
#7,729 brev 2 0%
#7,730 libudfread 2 0%
#7,731 proxy-ns 2 0%
#7,732 jlkendrick/tap/dirvana 2 0%
#7,733 uint2048/tap/lzssdec --HEAD 2 0%
#7,734 shivammathur/extensions/couchbase@8.6 2 0%
#7,735 triluch/lyrsmith/lyrsmith 2 0%
#7,736 shivammathur/extensions/opentelemetry@8.6 2 0%
#7,737 brannala/ba3/task@2 2 0%
#7,738 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libplacebo --with-zimg 2 0%
#7,739 shion92/omd/omd 2 0%
#7,740 marekaf/tap/batterybar 2 0%
#7,741 ronkeee/claude-code-usage-bar/claude-code-usage-bar 2 0%
#7,742 dsward2/tap/liveaudioserver 2 0%
#7,743 mrsalty/slowave/slowave 2 0%
#7,744 soarkey/tap/worktime 2 0%
#7,745 stress-ng 2 0%
#7,746 cataclysm 2 0%
#7,747 dedsecrattle/argus/argus-crawler 2 0%
#7,748 rioriost/tap/macocr 2 0%
#7,749 mm7894215/tokentracker/tokentracker 2 0%
#7,750 dfstudio/dfstudio/vips-scale 2 0%
#7,751 cvs-fast-export 2 0%
#7,752 danielalkurdi/matteros/matteros 2 0%
#7,753 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jack --with-libssh --with-rav1e --with-rtmpdump --with-srt --with-webp 2 0%
#7,754 mcp-scan 2 0%
#7,755 openbullet 2 0%
#7,756 knowoneactual/tap/isobar 2 0%
#7,757 wmbusmeters --HEAD 2 0%
#7,758 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-ctags --with-dbus --with-imagemagick --with-mailutils --without-cocoa 2 0%
#7,759 mysql-connector-c++ 2 0%
#7,760 kubelogin --HEAD 2 0%
#7,761 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-libplacebo 2 0%
#7,762 envato/envato-aws-vault/aws-vault 2 0%
#7,763 murodov20/tap/lat2cyr 2 0%
#7,764 shivammathur/extensions/msgpack@8.6 2 0%
#7,765 piyush-tyagi-13/ctxkit/ctxkit 2 0%
#7,766 pelikan 2 0%
#7,767 vismay299/speakflow/speakflow 2 0%
#7,768 robbielyman/seamstress/seamstress@1 2 0%
#7,769 vdirsyncer --HEAD 2 0%
#7,770 limadelic/tap/el 2 0%
#7,771 vicenzorm/tools/coge 2 0%
#7,772 zackriya-solutions/meetily-staging/meetily-backend 2 0%
#7,773 amterp/rad/rad 2 0%
#7,774 etcd-cpp-apiv3 2 0%
#7,775 glaze 2 0%
#7,776 mkasa/brow6el/brow6el 2 0%
#7,777 brewsci/science/neuron 2 0%
#7,778 dmoliveira/tap/loopmux 2 0%
#7,779 benletchford/tap/systemless 2 0%
#7,780 jumpyvi/experimental-tap/buildbox 2 0%
#7,781 protobuf@3.6 2 0%
#7,782 xooooooooox/patched/vfox 2 0%
#7,783 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libplacebo --with-librist --with-libsoxr --with-libvidstab --with-libvmaf --with-openjpeg --with-rav1e --with-rubberband --with-srt --with-svt-av1 --with-tesseract --with-webp --with-zeromq --with-zimg 2 0%
#7,784 freefem/freefem/freefem 2 0%
#7,785 pdfcraft-cli 2 0%
#7,786 premake 2 0%
#7,787 sokinpui/sync-clip/sync-clip 2 0%
#7,788 deezer/repo/caupain 2 0%
#7,789 ibehnam/packages/webpage-font-downloader 2 0%
#7,790 cppad 2 0%
#7,791 gperf 2 0%
#7,792 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-librist --with-librsvg --with-libssh --with-libvidstab --with-libxml2 --with-libzvbi --with-openal-soft --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-xvid 2 0%
#7,793 kimgyudong/prompt-cheater/prompt-cheater 2 0%
#7,794 carlosmenke/tab/refine-vibe-code 2 0%
#7,795 tam5/emacs-plus/emacs-plus@31 --with-debug 2 0%
#7,796 bear10591/tap/ffmpeg 2 0%
#7,797 toktop 2 0%
#7,798 mgxv/houdini/houdini 2 0%
#7,799 krisbradley/tap/crumbs --HEAD 2 0%
#7,800 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,801 ziadstr/nashmic/nashmic 2 0%
#7,802 vinn-ie/openems/csxcad 2 0%
#7,803 duti --HEAD 2 0%
#7,804 steipete/tap/songsee --HEAD 2 0%
#7,805 cdrtools 2 0%
#7,806 defai-digital/ax-engine/mlx 2 0%
#7,807 waariss/tap/whitebox-secure-scan 2 0%
#7,808 ethanzhrepo/md2pdf/md2pdf 2 0%
#7,809 jwt-hack 2 0%
#7,810 keyward 2 0%
#7,811 1mb-dev/tap/natcheck 2 0%
#7,812 tig --HEAD 2 0%
#7,813 valet-sh/core/vsh-elasticsearch7 2 0%
#7,814 strangeloopcanon/tap/talk 2 0%
#7,815 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jack --with-jpeg-xl --with-libplacebo --with-librist --with-libsoxr --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi 2 0%
#7,816 danielbayley/adobe/idml2xml 2 0%
#7,817 lucydodo/tap/sqlb-sqlcipher 2 0%
#7,818 growms/tap/ecf-cli 2 0%
#7,819 tcptraceroute 2 0%
#7,820 xbglowx/tap/vault-kv-search 2 0%
#7,821 gromgit/tap/twinpixcleaner 2 0%
#7,822 vasilescur/tap/lear 2 0%
#7,823 encoredev/tap/encore 2 0%
#7,824 ser2net 2 0%
#7,825 jonleed/tap/opencode2 2 0%
#7,826 lispnik/tecgraf/tecgraf-imlab 2 0%
#7,827 zurl --HEAD 2 0%
#7,828 mavryk-network/ligo/ligo 2 0%
#7,829 ldc 2 0%
#7,830 dtrukr/ioscpy/ioscpy 2 0%
#7,831 nscake/tap/ttrff --HEAD 2 0%
#7,832 test-swift 2 0%
#7,833 ndpi 2 0%
#7,834 peter46jan/dopamine/dopamine-code 2 0%
#7,835 bepi64/tap/git-tui 2 0%
#7,836 pkryger/emacsmacport-exp/emacs-mac-exp@31 --HEAD --with-arc --with-dbus --with-glib --with-imagemagick --with-mac-metal --with-modern-icon --with-optimization-flags --with-unlimited-select --with-xwidgets 2 0%
#7,837 tippecanoe 2 0%
#7,838 instead 2 0%
#7,839 bytepengfei/tap/container-docker-adapter 2 0%
#7,840 xml-security-c 2 0%
#7,841 dynein 2 0%
#7,842 multitail 2 0%
#7,843 mickeyl/formulae/simulacrum 2 0%
#7,844 filebeat 2 0%
#7,845 rv 2 0%
#7,846 jgavinray/tap/fleet-control 2 0%
#7,847 michael-amiethyst/bashpile5/bashpile --HEAD 2 0%
#7,848 harmonybrew/core/bender 2 0%
#7,849 xiw/jos/i386-jos-elf-gdb 2 0%
#7,850 yugabyte/tap/yb-voyager@2026.5.2 2 0%
#7,851 olivierpironneau/freefem/freefem 2 0%
#7,852 dekker1/minizinc/findmus 2 0%
#7,853 rnorth/tap/wyoming-mlx 2 0%
#7,854 aubepkg/tap/aube 2 0%
#7,855 eso/pipelines/hdrl 2 0%
#7,856 eso/pipelines/pyhdrl 2 0%
#7,857 atreb92/scrcrappy/scrcrappy 2 0%
#7,858 kiwakiwaa/tap/mkd-tools 2 0%
#7,859 snyk-agent-scan 2 0%
#7,860 llm 2 0%
#7,861 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libaribcaption 2 0%
#7,862 rgo/darktable/darktable 2 0%
#7,863 packetq 2 0%
#7,864 abd-k/tap/claudius 2 0%
#7,865 johanvdhaegen/tools/pytype 2 0%
#7,866 gearman 2 0%
#7,867 jingjing737/tap/devtools-hub 2 0%
#7,868 zk 2 0%
#7,869 nsis-dev/makensis/makensis@2.51 2 0%
#7,870 chikasuiro/tap/librcaprefiner 2 0%
#7,871 frostymur/tap/aeroflow 2 0%
#7,872 heavywatal/tap/phast 2 0%
#7,873 node --without-modules 2 0%
#7,874 eeyun/qemu-spice/libepoxy-egl 2 0%
#7,875 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --without-jansson --without-modules 2 0%
#7,876 aaratha/emacs-plus/emacs-plus@31 2 0%
#7,877 geekyshubham/olap/olap 2 0%
#7,878 malatenszki/agent-bridge/agent-bridge 2 0%
#7,879 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-black-dragon-icon --with-xwidgets 2 0%
#7,880 twilightcoders/tap/progresql 2 0%
#7,881 myzhang1029/myzhang1029/klayout --HEAD 2 0%
#7,882 caffeine-cli 2 0%
#7,883 smpeg 2 0%
#7,884 libkrun 2 0%
#7,885 shivama205/tap/excalidraw-render 2 0%
#7,886 rtmpdump --HEAD 2 0%
#7,887 ixmxvii-hash/pairio/pairio 2 0%
#7,888 tecolicom/tap/app-cat-v 2 0%
#7,889 patthemav/custom/ffmpeg-custom --with-speex --with-srt --with-svt-av1 --with-webp 2 0%
#7,890 bit-ship-dev/bit-ship/bit-ship 2 0%
#7,891 cxwx/cxbrew/emcee-cpp 2 0%
#7,892 harmonybrew/core/dalfox 2 0%
#7,893 pipe-rename 2 0%
#7,894 daylily-informatics/tap/wwk 2 0%
#7,895 d12frosted/emacs-plus/emacs-plus@28 --with-ctags 2 0%
#7,896 mrtazz/oss/plustache 2 0%
#7,897 execline 2 0%
#7,898 kmc2519-commits/dote/dote 2 0%
#7,899 timg --HEAD 2 0%
#7,900 cbenjamin23/tap/alog2media 2 0%
#7,901 diagram 2 0%
#7,902 borneygit/brew/pidcat 2 0%
#7,903 willyv3/tap/nextui 2 0%
#7,904 echidna --HEAD 2 0%
#7,905 d12frosted/emacs-plus/emacs-plus@30 --with-no-frame-refocus --with-savchenkovaleriy-big-sur-curvy-3d-icon 2 0%
#7,906 goimports 2 0%
#7,907 talkincode/tap/scorekit-sfizz 2 0%
#7,908 d12frosted/emacs-plus/emacs-plus@31 --with-mailutils --with-spacemacs-icon --with-xwidgets 2 0%
#7,909 xerxes-2/tap/steel --HEAD 2 0%
#7,910 minicom --HEAD 2 0%
#7,911 xerces-c 2 0%
#7,912 macpine 2 0%
#7,913 zdennis/bin/html-viewer 2 0%
#7,914 paulgalow/tap/albumart-dl 2 0%
#7,915 navicatgithub/monitor-3/navicatmonitor3 2 0%
#7,916 tracelore/wherefore/wherefore 2 0%
#7,917 fraluc06/tap/hunk 2 0%
#7,918 gmoqa/listen/listen 2 0%
#7,919 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-dvd 2 0%
#7,920 backbase/m/variants@1.3.0 2 0%
#7,921 nnutter/tap/roc --HEAD 2 0%
#7,922 blint 2 0%
#7,923 d12frosted/emacs-plus/emacs-plus@29 --with-modern-pen-icon --with-native-comp --with-no-frame-refocus --with-xwidgets 2 0%
#7,924 portop 2 0%
#7,925 samseenx/apps/imp 2 0%
#7,926 uutils-diffutils 2 0%
#7,927 cuba 2 0%
#7,928 terrascope 2 0%
#7,929 sqitchers/sqitch/sqitch --with-clickhouse-support --with-postgres-support 2 0%
#7,930 harmonybrew/core/etcd 2 0%
#7,931 imapotatoes11/tap/kme 2 0%
#7,932 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,933 gitu 2 0%
#7,934 openapi 2 0%
#7,935 amzyang/tap/iredis 2 0%
#7,936 harmonybrew/core/herdr 2 0%
#7,937 microsoft/mssql-release/msodbcsql18@18.6.2.1 2 0%
#7,938 sayansr26/rulegate/rulegate 2 0%
#7,939 rsql 2 0%
#7,940 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#7,941 idleberg/nsisbi/nsisbi@3.06.1.2 2 0%
#7,942 idleberg/nsisbi/nsisbi@3.06.1.1 2 0%
#7,943 idleberg/nsisbi/nsisbi@3.05.3 2 0%
#7,944 idleberg/nsisbi/nsisbi@3.05.2 2 0%
#7,945 localai --HEAD 2 0%
#7,946 ko10ok/all/doque 2 0%
#7,947 fbkarsdorp/lamachine/timbl 2 0%
#7,948 ljbuturovic/tap/llm-models 2 0%
#7,949 d12frosted/emacs-plus/emacs-plus@30 --with-dragon-icon --with-imagemagick 2 0%
#7,950 bitwise 2 0%
#7,951 scarvalhojr/tap/aoc-cli 2 0%
#7,952 manwithacat/tap/dazzle 2 0%
#7,953 brewsci/bio/genewise 2 0%
#7,954 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-doom-icon --with-native-comp --with-xwidgets 2 0%
#7,955 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-doom-icon --with-native-comp 2 0%
#7,956 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-modern-icon-elrumo1 --with-native-full-aot --with-tree-sitter --with-xwidgets 2 0%
#7,957 pts/utils/tif22pnm 2 0%
#7,958 tmbogus/treemix/treemix 2 0%
#7,959 djbclark/sudo-secretspec/sudo-secretspec 2 0%
#7,960 qtimageformats 2 0%
#7,961 walteh/tap/timebox 2 0%
#7,962 collectd 2 0%
#7,963 elmercsc/elmerfem/elmer --HEAD --without-hypre --without-mumps 2 0%
#7,964 shubaoyang/tap/music-player 2 0%
#7,965 dai199/kioku/kioku 2 0%
#7,966 d12frosted/emacs-plus/emacs-plus-local 2 0%
#7,967 timtogan/tim/libfuse@2 2 0%
#7,968 rfidresearchgroup/proxmark3/proxmark3 --with-generic --without-gd --without-qt@5 2 0%
#7,969 idleberg/nsisbi/nsisbi@3.05.1 2 0%
#7,970 hd-idle 2 0%
#7,971 schloegl/biosig/sigviewer 2 0%
#7,972 walk 2 0%
#7,973 dialog-if/brew/dialog-if 2 0%
#7,974 typos-cli 2 0%
#7,975 discount 2 0%
#7,976 codemaster-ar/clipboard-lite/clipboard-lite 2 0%
#7,977 acryldev/acryl/acryl 2 0%
#7,978 cartr/qt4/qt@4 --with-universal 2 0%
#7,979 lizardbyte/homebrew/sunshine --without-static-boost 2 0%
#7,980 lolcat 2 0%
#7,981 pigz 2 0%
#7,982 guile --HEAD 2 0%
#7,983 ledger --HEAD 2 0%
#7,984 moleui 2 0%
#7,985 42euge/geno/geno-tools --HEAD 2 0%
#7,986 nfpm 2 0%
#7,987 seethruhead/tap/screenorganizer 2 0%
#7,988 mbeddr/mbeddr/gdb76 2 0%
#7,989 smokris/getwindowid/getwindowid 2 0%
#7,990 hrntknr/tap/stablessh 2 0%
#7,991 zaxshen/tmb/trustmybot 2 0%
#7,992 aiyazmostofa/tap/emacs 2 0%
#7,993 d12frosted/emacs-plus/emacs-plus@29 --with-x11 2 0%
#7,994 gnmic 2 0%
#7,995 data-stack404/tap/md-changelog-linter 2 0%
#7,996 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-librsvg --with-unlimited-select 2 0%
#7,997 kareandersen/hatari-hrdb/hatari-hrdb --HEAD 2 0%
#7,998 zodwick/tap/sift-photos 2 0%
#7,999 oroddlokken/tap/dogcat 2 0%
#8,000 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jpeg-xl --with-libbluray --with-libvmaf --with-openapv --with-rav1e --with-webp 2 0%
#8,001 ddcutil 2 0%
#8,002 vsftpd 2 0%
#8,003 git-remote-hg 2 0%
#8,004 mbpoll 2 0%
#8,005 alliecatowo/tap/glassy 2 0%
#8,006 cimnine/armagetronad/armagetronad --HEAD 2 0%
#8,007 dungle-scrubs/rustybar/rustybar 2 0%
#8,008 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libbluray --with-libbs2b --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#8,009 knot 2 0%
#8,010 qshell 2 0%
#8,011 virustotal-cli 2 0%
#8,012 sampsyo/mspgcc/msp430-gcc 2 0%
#8,013 avpres/formulae/ffmpeg --with-openjpeg --with-rubberband --with-tesseract 2 0%
#8,014 mongo-c-driver@1 2 0%
#8,015 nanaminakano/gpoc/globalprotect-openconnect 2 0%
#8,016 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#8,017 harmonybrew/core/lld 2 0%
#8,018 cloud-officer/ci/soup 2 0%
#8,019 homebrew-ffmpeg/ffmpeg/ffmpeg --with-librsvg --with-rav1e --with-tesseract --with-webp --with-whisper-cpp 2 0%
#8,020 johanvdhaegen/tools/chktex 2 0%
#8,021 plzip 2 0%
#8,022 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-imagemagick --with-mailutils --with-modern-orange-icon --with-xwidgets 2 0%
#8,023 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-fdk-aac --with-game-music-emu --with-jack --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#8,024 brewsci/science/gnuastro 2 0%
#8,025 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#8,026 superbet-group/tap/teleport-cli 2 0%
#8,027 railwaycat/emacsmacport/emacs-mac@28 --with-modern-icon 2 0%
#8,028 octoenergy/tap/kraken-cli --HEAD 2 0%
#8,029 sourcekitten --HEAD 2 0%
#8,030 cliclick 2 0%
#8,031 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#8,032 rpiboot 2 0%
#8,033 xcid/tap/claude-bar 2 0%
#8,034 recutils 2 0%
#8,035 webservices-org/tap/dev 2 0%
#8,036 delph-in/delphin/ace --HEAD 2 0%
#8,037 scottryanhoward/riveter/riveter 2 0%
#8,038 nu --HEAD 2 0%
#8,039 baekho-lim/tap/secret-wallet 2 0%
#8,040 brewsci/bio/bifrost 2 0%
#8,041 phoneinfoga --HEAD 2 0%
#8,042 brad-x/custom/qemu-utm@7 2 0%
#8,043 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-modern-black-dragon-icon --with-xwidgets 2 0%
#8,044 amyy54/taps/wii --HEAD 2 0%
#8,045 dotbackup 2 0%
#8,046 cxa/emacs-plus/emacs-plus@30 --with-xwidgets 2 0%
#8,047 jsonnet 2 0%
#8,048 mutagen-io/mutagen/mutagen@0.17 2 0%
#8,049 kojinakamaru/emacsmacport/emacs-mac@29 --with-glib --with-librsvg --with-native-comp --with-xwidgets 2 0%
#8,050 openssl@3 --HEAD 2 0%
#8,051 rchekalov/silo/silo 2 0%
#8,052 johanvdhaegen/tools/python-lsp-server 2 0%
#8,053 shivammathur/extensions/excimer@8.6 2 0%
#8,054 dylandotat/brew/offpunk 2 0%
#8,055 4nzor/dbrowse/dbrowse 2 0%
#8,056 ariel-/crowdsec/crowdsec 2 0%
#8,057 osrf/simulation/ignition-math6 2 0%
#8,058 samurai 2 0%
#8,059 git-repair 2 0%
#8,060 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#8,061 chrisfu/tap/proxmark3 2 0%
#8,062 rweir/tap/dmarc-cat 2 0%
#8,063 gfsvn/tap/gfsvn 2 0%
#8,064 d12frosted/emacs-plus/emacs-plus@31 --with-c9rgreen-sonoma-icon --with-debug --with-imagemagick --with-xwidgets 2 0%
#8,065 open-ocd 2 0%
#8,066 roapi 2 0%
#8,067 osrf/simulation/ogre1.12 2 0%
#8,068 patchelf --HEAD 2 0%
#8,069 gnu-smalltalk --HEAD 2 0%
#8,070 emergetools/tap/archivethin 2 0%
#8,071 propythoncoderaya/q-tip/q-tip --HEAD 2 0%
#8,072 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jack --with-openssl@3 --with-openvino --with-speex --with-srt --with-webp 2 0%
#8,073 lifepillar/appleii/pom1 2 0%
#8,074 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-mailutils --with-modern-bokehlicia-captiva-icon --with-xwidgets 2 0%
#8,075 unxmaal/ctp500/ctp500-printer 2 0%
#8,076 aerleon 2 0%
#8,077 bigcoke233/tap/wthis 2 0%
#8,078 jerson/tap/screenshot-tools 2 0%
#8,079 mujs 2 0%
#8,080 peachlifeab/tap/bgtail 2 0%
#8,081 bensimpsonvf/kiro-cli-standalone/kiro-cli-standalone 2 0%
#8,082 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-elrumo2-icon --with-imagemagick --with-mailutils --with-modern-icon --with-xwidgets 2 0%
#8,083 d12frosted/emacs-plus/emacs-plus@30 --HEAD --with-spacemacs-icon 2 0%
#8,084 rowansail/tap/lanes 2 0%
#8,085 d12frosted/emacs-plus/emacs-plus@30 --with-modern-vscode-icon 2 0%
#8,086 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-comp --with-starter 2 0%
#8,087 tuios --HEAD 2 0%
#8,088 postgis --HEAD 2 0%
#8,089 triformai/tap/triform-cli 2 0%
#8,090 d12frosted/emacs-plus/emacs-plus@31 --with-memeplex-wide-icon 2 0%
#8,091 shepherd 2 0%
#8,092 atari800 --HEAD 2 0%
#8,093 cookcli 2 0%
#8,094 darrenburns/homebrew/posting 2 0%
#8,095 buckleypaul/tap/blescan 2 0%
#8,096 html2text 2 0%
#8,097 dfinity/tap/icp-cli 2 0%
#8,098 ki 2 0%
#8,099 ctxme/cli/cli 2 0%
#8,100 torkjacobs/tap/tork 2 0%
#8,101 gcx 2 0%
#8,102 coccinelle --HEAD 2 0%
#8,103 piti-diablotin/tap/qagate 2 0%
#8,104 ngs 2 0%
#8,105 harmonybrew/core/lerna 2 0%
#8,106 harmonybrew/core/isl 2 0%
#8,107 xdpxi/tap/sponge 2 0%
#8,108 flatscrew/osx/rasterflow 2 0%
#8,109 hlship/brew/dialog-tool 2 0%
#8,110 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jack --with-jpeg-xl --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 2 0%
#8,111 contensis/cli/contensis-cli-spike 2 0%
#8,112 d12frosted/emacs-plus/emacs-plus@30 --with-dragon-icon 2 0%
#8,113 yafc 2 0%
#8,114 kabel/pecl/php-swoole 2 0%
#8,115 clipper2 2 0%
#8,116 danielbayley/dotfiles/rawgrep 2 0%
#8,117 cartermcalister/tools/aerospace-layout-manager 2 0%
#8,118 denji/nginx/nginx-full --with-rtmp-module 2 0%
#8,119 bssm-oss/cotor/cotor 2 0%
#8,120 homebrew-ffmpeg/ffmpeg/ffmpeg --with-rav1e --with-webp 2 0%
#8,121 ghc --HEAD 2 0%
#8,122 tworingsoft/formulae/vrsn 2 0%
#8,123 nono 2 0%
#8,124 hikoyu/shogi/fukauraou_coreml 2 0%
#8,125 alpheuscef/tap/fin 2 0%
#8,126 pgenie-io/tap/pgn --HEAD 2 0%
#8,127 laibulle/tap/protokol-cli 2 0%
#8,128 dancek/misc/ufag --HEAD 2 0%
#8,129 saturn4er/apihop/apihop 2 0%
#8,130 jd 2 0%
#8,131 bhf/st-k8s/st-k8s 2 0%
#8,132 x86_64-elf-grub 2 0%
#8,133 jnoortheen/timescaledb-tap/timescaledb 2 0%
#8,134 game-music-emu 2 0%
#8,135 pcaudiolib 2 0%
#8,136 blastem --HEAD 2 0%
#8,137 timvw/tap/bose 2 0%
#8,138 openkermit 2 0%
#8,139 harmonybrew/core/erlang 2 0%
#8,140 railwaycat/emacsmacport/emacs-mac 2 0%
#8,141 railwaycat/emacsmacport/emacs-mac@31exp --with-librsvg --with-native-compilation --without-modules 2 0%
#8,142 vcluster 2 0%
#8,143 siriokds/dual-audio/dual-libvgm 2 0%
#8,144 pandasir/tap/gander 2 0%
#8,145 radiantlogic-devops/tap/eocctl 2 0%
#8,146 qcoro6 2 0%
#8,147 rolldice 2 0%
#8,148 0x251c08/psi/psi 2 0%
#8,149 ledger 2 0%
#8,150 eslamalii/tap/pix 2 0%
#8,151 chandansgowda/tap/posture-fix 2 0%
#8,152 libogg 2 0%
#8,153 fairy-stockfish 2 0%
#8,154 bibtexconv 2 0%
#8,155 zaalipro/cymphony/cymphony 2 0%
#8,156 router-for-me/core/cliproxyapi 2 0%
#8,157 katosh/tools/agent-sandbox 2 0%
#8,158 rfidresearchgroup/proxmark3/proxmark3 --with-generic --with-small --with-smartcard 2 0%
#8,159 rofs-filtered 2 0%
#8,160 lifepillar/appleii/llvm-6502 2 0%
#8,161 lifepillar/appleii/passport 2 0%
#8,162 osrf/simulation/player 2 0%
#8,163 redis-developer/core/redisearch --HEAD 2 0%
#8,164 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-big-sur-icon --with-mac-metal --with-native-compilation --with-natural-title-bar --with-starter 2 0%
#8,165 johanvdhaegen/tools/trilinos-xyce 2 0%
#8,166 snitch 2 0%
#8,167 dufs 2 0%
#8,168 punt-labs/tap/lux 2 0%
#8,169 mrpollo/plotjuggler/plotjuggler 2 0%
#8,170 hkievet/pdfmirror/pdfmirror 2 0%
#8,171 brewsci/bio/racon 2 0%
#8,172 lgarron/lgarron/tailscale-exit-node --HEAD 2 0%
#8,173 fabric-ai --HEAD 2 0%
#8,174 glooctl 2 0%
#8,175 ql 2 0%
#8,176 mdfried 2 0%
#8,177 gruyere 2 0%
#8,178 chef/chefops-tools/aws-mfa 2 0%
#8,179 binsquare/era-agent-cli/libkrun@1.15.1 2 0%
#8,180 litehtml 2 0%
#8,181 brewsci/science/galib 2 0%
#8,182 uvuowh/project-graph/project-graph 2 0%
#8,183 go@1.23 2 0%
#8,184 qttranslations 2 0%
#8,185 openemv/tap/emv-utils --HEAD 2 0%
#8,186 ballerburg 2 0%
#8,187 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-decklink 2 0%
#8,188 rdp/openssh-gssapi/openssh-patched --with-hpn 2 0%
#8,189 brewsci/bio/peat 2 0%
#8,190 mrxcitement/cafeconpan/emacs@30.2 2 0%
#8,191 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#8,192 tergel-996/yapp/yapp 2 0%
#8,193 bookokrat 2 0%
#8,194 circumflex 2 0%
#8,195 mbedtls@2 2 0%
#8,196 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-starter --with-unlimited-select --with-xwidgets 2 0%
#8,197 google/verible/verible 2 0%
#8,198 pietro/tap/ga68 2 0%
#8,199 airspy 2 0%
#8,200 ta7mid/tap/gridpack 2 0%
#8,201 kilo-loco/tap/vastai 2 0%
#8,202 gabriel-feang/partitura-cli/partitura-cli --HEAD 2 0%
#8,203 kuperman/sysvbanner/sysvbanner 2 0%
#8,204 elmercsc/elmerfem/elmer --without-mumps --without-open-mpi 2 0%
#8,205 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libvmaf --with-svt-av1 2 0%
#8,206 lgarron/lgarron/toggle-display --HEAD 2 0%
#8,207 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-svt-av1 2 0%
#8,208 enkaidu 2 0%
#8,209 randybias/tap/zerofs 2 0%
#8,210 c0ntinuum/scriptcs/scriptcs 2 0%
#8,211 drpedapati/tap/irl 2 0%
#8,212 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-sexy-v2-icon --with-native-comp --with-xwidgets 2 0%
#8,213 danielbair/tap/festival 2 0%
#8,214 danielbair/tap/backports 2 0%
#8,215 coryfklein/tap/notif 2 0%
#8,216 a2ps 2 0%
#8,217 qso-graph/mcp/solar-mcp 2 0%
#8,218 twam/openfpga/nextpnr --without-arch-ecp5 2 0%
#8,219 bolmaster2/curl-openssl/curl-openssl@1.1 2 0%
#8,220 v-gutierrez/gw/gw 2 0%
#8,221 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 2 0%
#8,222 flann 2 0%
#8,223 brewsci/science/igvtools 2 0%
#8,224 hurl --HEAD 2 0%
#8,225 d12frosted/emacs-plus/emacs-plus@29 --with-modern-black-variant-icon --with-no-frame-refocus 2 0%
#8,226 david0/audio/ardour5 2 0%
#8,227 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-native-comp --with-natural-title-bar 2 0%
#8,228 gnu-barcode 2 0%
#8,229 hlrs-vis/tap/apitrace 2 0%
#8,230 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-native-comp --with-native-full-aot --with-pdumper --with-retro-icon-gnu-head --with-tree-sitter --with-xwidgets 2 0%
#8,231 lilypond --HEAD 2 0%
#8,232 0f-0b/mkxp/mkxp --with-fluid-synth 2 0%
#8,233 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libssh --with-openssl --with-rav1e --with-rtmpdump --with-speex --with-srt --with-svt-av1 --with-two-lame --with-whisper-cpp --with-xvid 2 0%
#8,234 nping 2 0%
#8,235 filessh 2 0%
#8,236 sutrianoto/openlitespeed/admin_php 2 0%
#8,237 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-ctags --with-imagemagick --with-xwidgets 2 0%
#8,238 glibmm@2.46.4 2 0%
#8,239 languagetool --HEAD 2 0%
#8,240 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-no-title-bars --with-starter --with-unlimited-select 2 0%
#8,241 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-imagemagick --with-native-comp --with-natural-title-bar 2 0%
#8,242 brewsci/science/symphony 2 0%
#8,243 devleaps/brew/agent-policies 2 0%
#8,244 myzhang1029/myzhang1029/rusty-penguin 2 0%
#8,245 madanlalit/tap/progress 2 0%
#8,246 aaratha/emacs-plus/emacs-plus@29 2 0%
#8,247 d12frosted/emacs-plus/emacs-plus@31 --with-elrumo2-icon 2 0%
#8,248 la5nta/tap/pat 2 0%
#8,249 alovn/catalina/go 2 0%
#8,250 seek-one/ffmpeg/ffmpeg --with-fdk-aac --with-freetype --with-harfbuzz --with-libass --with-libvpx --with-openh264 2 0%
#8,251 elio-fm/elio/elio 2 0%
#8,252 hoonkim/tap/timecat 2 0%
#8,253 cfergeau/crc/crc-admin-helper 2 0%
#8,254 ottomatic-io/video/bmx 2 0%
#8,255 astra 2 0%
#8,256 d12frosted/emacs-plus/emacs-plus@32 --with-compress-install --with-debug --with-xwidgets 2 0%
#8,257 speedtest-cli --HEAD 2 0%
#8,258 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-mac-metal --with-native-compilation 2 0%
#8,259 jwt-cli 2 0%
#8,260 kunmyonchoi/tap/sizer 2 0%
#8,261 d12frosted/emacs-plus/emacs-plus@31 --with-dragon-icon --with-xwidgets 2 0%
#8,262 vilmire/adhdev/adhdev 2 0%
#8,263 fd --HEAD 2 0%
#8,264 heirloom-sh 2 0%
#8,265 hlrs-vis/tap/vsgxchange --HEAD 2 0%
#8,266 tolgamorf/tap/env2op-cli 2 0%
#8,267 realagiorganization/tap/discord-caps-copy-paste 2 0%
#8,268 d12frosted/emacs-plus/emacs-plus@29 --with-modern-sexy-v1-icon --with-native-comp 2 0%
#8,269 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-native-comp --with-xwidgets 2 0%
#8,270 sinsniwal/hey-cli/hey-cli 2 0%
#8,271 t4g/vadas/vadas 2 0%
#8,272 d12frosted/emacs-plus/emacs-plus@30 --with-modern-paper-icon --with-savchenkovaleriy-big-sur-3d-icon --with-xwidgets 2 0%
#8,273 opensearch-dashboards 2 0%
#8,274 sunnyyoung/tap/wechattweak 2 0%
#8,275 oothecapickle/idevicerestore/idevicerestore --HEAD 2 0%
#8,276 sqlambda/pg-licht/pg-licht 2 0%
#8,277 gerritforge/gerrit/gerrit@3.12.7 2 0%
#8,278 kabel/pecl/php-phalcon 2 0%
#8,279 wiredtiger 2 0%
#8,280 cxwx/cxbrew/bilibili-tui 2 0%
#8,281 kareandersen/hatari-hrdb/hatari-hrdb 2 0%
#8,282 d12frosted/emacs-plus/emacs-plus@30 --with-memeplex-wide-icon 2 0%
#8,283 gupnp 2 0%
#8,284 d12frosted/emacs-plus/emacs-plus@32 --with-debug 2 0%
#8,285 tomtom-international/taps/clang-format@6 2 0%
#8,286 svt/avtools/libdf 2 0%
#8,287 eas-cli 2 0%
#8,288 timbuchinger/tap/agent-align 2 0%
#8,289 robinmollah/tap/chatgpt --HEAD 2 0%
#8,290 psutils 2 0%
#8,291 shivammathur/php/php@8.5-gcc 2 0%
#8,292 keynest 2 0%
#8,293 bl4cc4t/other/arc_unpacker --HEAD 2 0%
#8,294 moonfruit/tap/sing-box-apple 2 0%
#8,295 ahsanhabibakik/tap/aiusage-tracker 2 0%
#8,296 stockfish --HEAD 2 0%
#8,297 viamrobotics/brews/viam-server 2 0%
#8,298 hlrs-vis/tap/open-audio-server --HEAD 2 0%
#8,299 nanaian/brew/mips-linux-gnu-gcc 2 0%
#8,300 freecad/freecad/freecad@1.1.0_py313_qt6 --HEAD 2 0%
#8,301 dyx884877791/i386-jos-elf-gcc/glib-jos-2824 2 0%
#8,302 sagar-18/aidometer/aidometer 2 0%
#8,303 eugenmayer/dockersync/unox --HEAD 2 0%
#8,304 fricas 2 0%
#8,305 emersonding/tap/lumen 2 0%
#8,306 dm-chase/kokoro-tts/kokoro-tts-server 2 0%
#8,307 ccsepbvr/pbvr/pbvr-extended-fileformat 2 0%
#8,308 clevercloud/tap/clever-tools --without-bash-completion 2 0%
#8,309 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#8,310 arvicco/podgen/podgen 2 0%
#8,311 alberthuangt/arm-tui/arm-tui 2 0%
#8,312 khal --HEAD 2 0%
#8,313 ataraxy-labs/tap/sem 2 0%
#8,314 8b-is/tap/qwave 2 0%
#8,315 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-debug --with-imagemagick --with-mailutils --with-no-frame-refocus --with-xwidgets 2 0%
#8,316 gcalcli 2 0%
#8,317 onefetch 2 0%
#8,318 rakudo 2 0%
#8,319 wla-dx 2 0%
#8,320 ios-class-guard 2 0%
#8,321 likelion/tap/swipl 2 0%
#8,322 horimislime/taproom/xcstats 2 0%
#8,323 kreuzberg-dev/tap/alef 2 0%
#8,324 maurymarkowitz/tap/onec 2 0%
#8,325 tagref 2 0%
#8,326 cpu_features 2 0%
#8,327 bl4cc4t/vsplugins/vsp-knlmeanscl --HEAD 2 0%
#8,328 mapnik 2 0%
#8,329 gemnasium/gemnasium/gemnasium-toolbelt 2 0%
#8,330 liuyanlong1345-create/tap/easyshell 2 0%
#8,331 apprise 2 0%
#8,332 harmonybrew/core/po4a 2 0%
#8,333 bindfs 2 0%
#8,334 ldid-procursus 2 0%
#8,335 sslscan 2 0%
#8,336 maven 2 0%
#8,337 timescale/tap/timescaledb --with-oss-only --without-timescaledb-tools 2 0%
#8,338 lokkaflokka/tap/eventkit-cli 2 0%
#8,339 jeffscottbrown/jerry/jerry 2 0%
#8,340 robzombie3434/tap/audio-mta 2 0%
#8,341 verivus-oss/sqry/sqry --HEAD 2 0%
#8,342 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-natural-title-bar 2 0%
#8,343 amlel-el-mahrouss/mips64/qemu-irix 2 0%
#8,344 gmrandazzo/gmr/netdiscover 2 0%
#8,345 openclaw/tap/gitcrawl --HEAD 2 0%
#8,346 totakke/obdgpslogger/obdgpslogger 2 0%
#8,347 myzhang1029/myzhang1029/aarch64-mingw-w64 --HEAD 2 0%
#8,348 pleymor/mov2mp4/mov2mp4 2 0%
#8,349 chinapandaman/tap/pypdfform 2 0%
#8,350 pypy3.11 2 0%
#8,351 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-no-frame-refocus --with-xwidgets 2 0%
#8,352 josephholsten/josephholsten/flor --HEAD 2 0%
#8,353 c4g-john/tap/docassert 2 0%
#8,354 mac-cleanup/mac-cleanup-py/mac-cleanup-py 2 0%
#8,355 lilypond 2 0%
#8,356 datafusion 2 0%
#8,357 agentscore/tap/agentscore-pay 2 0%
#8,358 volkm/storm/stormchecker 2 0%
#8,359 d12frosted/emacs-plus/emacs-plus@30 --with-x11 --with-imagemagick --with-mailutils 2 0%
#8,360 thomasmaerz/virt-manager/virt-manager 2 0%
#8,361 romankurnovskii/awesome-brew/openssl@1.0 2 0%
#8,362 elmercsc/elmerfem/elmer --HEAD --without-hypre --without-mumps --without-open-mpi 2 0%
#8,363 francofrizzo/tap/print-label 2 0%
#8,364 dxrcy/elk/elk-mc --HEAD 2 0%
#8,365 vertti/lazy-ecs/lazy-ecs 2 0%
#8,366 amrkmn/tap/playit-agent 2 0%
#8,367 shivammathur/php/php@7.1-debug 2 0%
#8,368 glances --HEAD 2 0%
#8,369 versus/tap/yawsso 2 0%
#8,370 anneschuth/tap/parro 2 0%
#8,371 askgitdev/askgit/mergestat 2 0%
#8,372 netscanner 2 0%
#8,373 souffle 2 0%
#8,374 e0ipso/self-review/self-review 2 0%
#8,375 mickeyl/formulae/lsusd 2 0%
#8,376 prophesourvolodymyr/wtfis/wtfis 2 0%
#8,377 sql-migrate 2 0%
#8,378 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-libaribb24 2 0%
#8,379 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-libssh --with-libvmaf --with-tesseract 2 0%
#8,380 dgop 2 0%
#8,381 gm5dna/amateur-radio/linbpq 2 0%
#8,382 cmix 2 0%
#8,383 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-dbus --with-imagemagick --with-mailutils 2 0%
#8,384 libid3tag 2 0%
#8,385 sebastianhaberey/easyborg/easyborg 2 0%
#8,386 labelle 2 0%
#8,387 shopify/shopify/cmake30 --without-docs 2 0%
#8,388 fastgron 2 0%
#8,389 hoveradev/formulae/mips64-elf-gcc 2 0%
#8,390 systemc 2 0%
#8,391 pasogott/tap/frappecli --HEAD 2 0%
#8,392 wrogistefan/desktop-2fa/desktop-2fa 2 0%
#8,393 torres-atlantic/multikey/multikey 2 0%
#8,394 xray --HEAD 2 0%
#8,395 autogen 2 0%
#8,396 robertgzr/tap/iosevka 2 0%
#8,397 askgitdev/treequery/treequery 2 0%
#8,398 d12frosted/emacs-plus/emacs-plus@29 --with-dbus --with-imagemagick --with-native-comp --with-xwidgets 2 0%
#8,399 lgarron/lgarron/tagpush --HEAD 2 0%
#8,400 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-imagemagick --with-modern-pen-3d-icon 2 0%
#8,401 railwaycat/emacsmacport/emacs-mac@29 --with-gnu-head-icon --with-native-compilation --with-no-title-bars --with-starter 2 0%
#8,402 magic-ingredients/tap/tiny-brain 2 0%
#8,403 ouroboros-ai 2 0%
#8,404 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-mac-metal --with-native-compilation 2 0%
#8,405 byobu 2 0%
#8,406 wyattau/suture-merge-driver/suture-merge-driver 2 0%
#8,407 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-big-sur-icon 2 0%
#8,408 recursivetree/xtrkcad/xtrkcad 2 0%
#8,409 hyperscan 2 0%
#8,410 brewsci/science/flexbar 2 0%
#8,411 wayback 2 0%
#8,412 faketty 2 0%
#8,413 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-modern-icon --with-native-compilation 2 0%
#8,414 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-starter --without-modules 2 0%
#8,415 vansh-raja/tap/sshthing --HEAD 2 0%
#8,416 dfinity/tap/icp-cli-network-launcher 2 0%
#8,417 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-dbus --with-imagemagick --with-mailutils --with-modern-icon-alecive-flatwoken --with-native-comp --with-pdumper --with-tree-sitter --with-xwidgets 2 0%
#8,418 twam/openfpga/icestorm 2 0%
#8,419 jimfangx/riscv/riscv-openocd 2 0%
#8,420 fredldotme/qemu-virgl/qemu-virgl 2 0%
#8,421 demers-eric/tap/nanobar --HEAD 2 0%
#8,422 rfidresearchgroup/proxmark3/proxmark3 --with-small --with-smartcard 2 0%
#8,423 satoken/rnatools/ipknot 2 0%
#8,424 shuyang790/easyhg/easyhg 2 0%
#8,425 sassc 2 0%
#8,426 sui 2 0%
#8,427 stevelacey/tap/wifi-cli 2 0%
#8,428 picotool 2 0%
#8,429 theapplegates/kleopatra6mac/kf6-solid 2 0%
#8,430 tamia6/tap/rfig 2 0%
#8,431 denji/nginx/nginx-full --with-addition --with-debug --with-http-remote-passwd-module --with-http2 --with-image-filter --with-passenger 2 0%
#8,432 gisogrimm/tap/ovbox 2 0%
#8,433 jonahsnider/frc/choreo-cli 2 0%
#8,434 valet-sh/core/vsh-mysql80 2 0%
#8,435 deus0ww/tap/ffmpeg --HEAD 2 0%
#8,436 as-tree 2 0%
#8,437 libgedit-amtk 2 0%
#8,438 rmux 2 0%
#8,439 amal-ak47/lucrativetext/lucrativetext 2 0%
#8,440 nub 2 0%
#8,441 cartr/qt4/qt@4 --with-debug 2 0%
#8,442 dekker1/minizinc/yuck 2 0%
#8,443 d12frosted/emacs-plus/emacs-plus@30 --with-memeplex-slim-icon 2 0%
#8,444 rustls-ffi 2 0%
#8,445 k3min/n64-dev/mips64-elf-gcc 2 0%
#8,446 rfidresearchgroup/proxmark3/proxmark3 --with-lf-tharexde 2 0%
#8,447 godns 2 0%
#8,448 sqlitebrowser/tap/sqlb-icu4c 2 0%
#8,449 librtlsdr 2 0%
#8,450 fuse-zip 2 0%
#8,451 asciinema 2 0%
#8,452 maenpaa24/monterey/p11-kit 2 0%
#8,453 cppcms 2 0%
#8,454 kitschpatrol/tap/yanki 2 0%
#8,455 offlineimap 2 0%
#8,456 osm-pbf 2 0%
#8,457 ottijp/tap/pdf-r2l 2 0%
#8,458 rfidresearchgroup/proxmark3/proxmark3 --with-generic --without-standalone 2 0%
#8,459 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#8,460 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libplacebo --with-openh264 --with-rav1e 2 0%
#8,461 libxml++@5 2 0%
#8,462 ryan-robeson/gimp/libgimp2.0@2.10.18 2 0%
#8,463 galaxyhaze/zith/zith 2 0%
#8,464 sisyphusmd/tap/whiskerless-rc 2 0%
#8,465 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-libssh --with-libvmaf --with-srt --with-webp 2 0%
#8,466 raulgg/tap/pods-control 2 0%
#8,467 homebrew-ffmpeg/ffmpeg/ffmpeg --with-openssl@3 2 0%
#8,468 pkg-config-wrapper 2 0%
#8,469 kfet/til/til 2 0%
#8,470 arcadi4/tap/headroom 2 0%
#8,471 bpingris/tap/openclose --HEAD 2 0%
#8,472 ssmendon/extras/sk-libfido2 2 0%
#8,473 java-service-wrapper 2 0%
#8,474 pothosware/pothos/soapysdr --HEAD 2 0%
#8,475 benchagi/openclaw/openclaw 2 0%
#8,476 dbt-labs/dbt/dbt-bigquery 2 0%
#8,477 andyshinn/mesh/meshcore-cli 2 0%
#8,478 send/tap/macnotifier 2 0%
#8,479 nicholasdominici/tap/holler 2 0%
#8,480 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-mailutils --with-native-comp --with-retro-icon-gnu-head --with-tree-sitter --with-xwidgets 2 0%
#8,481 jacobbednarz/tap/dnstrace 2 0%
#8,482 johanvdhaegen/tools/copybara 2 0%
#8,483 libnotify 2 0%
#8,484 arcadi4/tap/pnpm@12 2 0%
#8,485 denji/nginx/nginx-full --with-addition --with-auth-pam-module --with-auth-req --with-dav-ext-module --with-debug --with-echo-module --with-gunzip --with-gzip-static --with-headers-more-module --with-http2 --with-mail --with-mail-ssl --with-pcre-jit --with-realip --with-slice --with-status --with-stream --with-stream-ssl --with-stream-ssl-preread --with-sub --with-subs-filter-module --with-webdav --with-xslt 2 0%
#8,486 thefanatr/slang/slang 2 0%
#8,487 wstein/tap/cx-cli 2 0%
#8,488 slint-cpp 2 0%
#8,489 spichen/tap/specrun 2 0%
#8,490 lldddv2/astrodb/astrodb 2 0%
#8,491 yosefalsuhaibani/core/semgrep 2 0%
#8,492 mnewberry/fdsel/fdsel 2 0%
#8,493 aarondfrancis/tap/counselors 2 0%
#8,494 graelo/tap/podfeed 2 0%
#8,495 worker-build 2 0%
#8,496 sqlitebrowser/tap/sqlb-qt@5 2 0%
#8,497 gaoscode/tap/planweave 2 0%
#8,498 ompl 2 0%
#8,499 pushkinist/rmlx/rmlx 2 0%
#8,500 hitpointx/tasky/tasky 2 0%
#8,501 d12frosted/emacs-plus/emacs-plus@27 2 0%
#8,502 rocq --HEAD 2 0%
#8,503 zim-tools 2 0%
#8,504 medusa 2 0%
#8,505 s2geometry 2 0%
#8,506 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libxml2 2 0%
#8,507 git-flow-next 2 0%
#8,508 tdlib 2 0%
#8,509 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-opencore-amr --with-openjpeg --with-rav1e --with-two-lame --with-webp --with-xvid 2 0%
#8,510 atlas 2 0%
#8,511 extra-cmake-modules 2 0%
#8,512 aderuelle/tap/libgeneral 2 0%
#8,513 julienmoumne/hotshell/hs 2 0%
#8,514 kuzu 2 0%
#8,515 gimme-aws-creds --HEAD 2 0%
#8,516 pyspelling 2 0%
#8,517 thefirstistari/strisk/strisk 2 0%
#8,518 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-native-comp --with-natural-title-bar --with-starter --with-xwidgets 2 0%
#8,519 abinit/tap/netcdf-parallel 2 0%
#8,520 gerlero/openfoam/styro 2 0%
#8,521 denji/nginx/nginx-full --with-perl 2 0%
#8,522 prjtrellis 2 0%
#8,523 diktoapp/dikto/dikto 2 0%
#8,524 bearing-darwin-arm64 2 0%
#8,525 filosottile/musl-cross/musl-cross --with-arm 2 0%
#8,526 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-imagemagick --with-librsvg --with-native-comp --with-xwidgets 2 0%
#8,527 micronaut 2 0%
#8,528 shamim0902/tap/locus 2 0%
#8,529 vglafirov/openduo/openduo 2 0%
#8,530 pushpin 2 0%
#8,531 open-image-denoise 2 0%
#8,532 stella 2 0%
#8,533 cyakimov/tap/treepi 2 0%
#8,534 ajeebtech/tap/ascii-cam 2 0%
#8,535 haiquand/yubikey-ssh/ssh-askpass-mac 2 0%
#8,536 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 2 0%
#8,537 atpugvaraa/swiftjs/create-swiftjs-app 2 0%
#8,538 pip-tools 2 0%
#8,539 lua@5.4 2 0%
#8,540 godart-corentin/devjournal/devjournal 2 0%
#8,541 peco --HEAD 2 0%
#8,542 rails-mcp-server 2 0%
#8,543 fluent-bit 2 0%
#8,544 cfripper 2 0%
#8,545 botinate/tap/odysseus-patches 2 0%
#8,546 kensanjournal/tap/kensan-ea 2 0%
#8,547 willyv3/tap/vinw-workspace 2 0%
#8,548 goaccess --HEAD 2 0%
#8,549 digital-defiance/tap/findutils-brightdate 2 0%
#8,550 elmercsc/elmerfem/elmer --with-elmergui 2 0%
#8,551 sherlock 2 0%
#8,552 lifelines 2 0%
#8,553 s6-rc 2 0%
#8,554 pilan-ai/tap/mnemo 2 0%
#8,555 huncrys/tap/git-warp-time 2 0%
#8,556 snakeviz 2 0%
#8,557 pavanpaik/tools/inbox-cli 2 0%
#8,558 imgdiet 2 0%
#8,559 dhruv-anand-aintech/tap/wifi-priority-tui 2 0%
#8,560 shivammathur/extensions/seaslog@8.2 2 0%
#8,561 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-dbus --with-imagemagick --with-mailutils --with-tree-sitter --with-xwidgets --without-gnutls 2 0%
#8,562 termsurf/termsurf/termsurf 2 0%
#8,563 ivasuy/tap/vibedeck 2 0%
#8,564 xiw/crossbuild/x86_64-linux-gnu-gdb 2 0%
#8,565 rbbtsn0w/tap/gh-address-cr 2 0%
#8,566 openunison/ouctl/ouctl 2 0%
#8,567 probitas-test/tap/probitas 2 0%
#8,568 osx-cross/avr/avr-gcc@11 2 0%
#8,569 nasiridrishi/tap/yank 2 0%
#8,570 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-dbus --with-debug --with-imagemagick --with-xwidgets 2 0%
#8,571 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jpeg-xl --with-libplacebo --with-librsvg --with-libsoxr --with-libvmaf --with-openjpeg --with-rav1e --with-rubberband --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 2 0%
#8,572 alex-shumeika/tap/quickrun 2 0%
#8,573 gildas/tap/git-credential-bitbucket 2 0%
#8,574 pgpbpadilla/pgpb/gnupg@2.2.41 2 0%
#8,575 nyuichi/satysfi/satysfi --HEAD 2 0%
#8,576 filosottile/musl-cross/musl-cross --with-mips 2 0%
#8,577 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libflite --with-librsvg --with-libsoxr --with-libssh --with-libxml2 --with-openapv --with-opencore-amr --with-openh264 --with-openssl --with-two-lame --with-webp 2 0%
#8,578 durbek-saydaliyev/orbit/orbit 2 0%
#8,579 shivammathur/extensions/sqlsrv@8.6 2 0%
#8,580 roelofrossouw/sc/simply-cpp-graphics 2 0%
#8,581 sparkworx/stuff/serena 2 0%
#8,582 akatmks/vapoursynth-plugins/ffmpeg-home-of-avisynthplus-evolution --HEAD 2 0%
#8,583 tagatac/bagoup/bagoup 2 0%
#8,584 nxproxy 2 0%
#8,585 bgunnarsson/binvim/binvim 2 0%
#8,586 audiofilter/spuc/spuce 2 0%
#8,587 rqlite 2 0%
#8,588 kakoune --HEAD 2 0%
#8,589 honkeandpastrami/tap/firefly-preimporter 2 0%
#8,590 vespa-cli 2 0%
#8,591 aarch64-mingw-w64 2 0%
#8,592 indirect/tap/flowershow 2 0%
#8,593 nshipster/formulae/swift-format 2 0%
#8,594 amlel-el-mahrouss/mips64/mips64-elf-gcc 2 0%
#8,595 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 2 0%
#8,596 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick-full --with-xwidgets 2 0%
#8,597 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libaribb24 --with-librist --with-libsoxr --with-libvidstab --with-libvmaf --with-openh264 --with-rav1e --with-rubberband --with-srt --with-webp --with-zeromq --with-zimg 1 0%
#8,598 outscale/tap/osc-tui 1 0%
#8,599 krishcdbry/tap/control-tower 1 0%
#8,600 vangie/formula/wechat-moments 1 0%
#8,601 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libmodplug --with-libopenmpt --with-librist --with-librsvg --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#8,602 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#8,603 muneebshahid/tap/ox 1 0%
#8,604 denji/nginx/nginx-full --with-array-var-module --with-auth-pam-module --with-auth-req --with-fancyindex-module --with-flv --with-geoip2-module --with-http2 --with-http3 --with-image-filter --with-mail --with-mail-ssl --with-mp4 --with-mp4-h264-module --with-realip --with-rtmp-module --with-status --with-stream-ssl --with-upload-module --with-vod-module --with-vts-module --with-websockify-module 1 0%
#8,605 mods 1 0%
#8,606 chronoscrat/tap-public/airflowctl 1 0%
#8,607 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-webp --with-zimg 1 0%
#8,608 crimson-knight/tap/shards-alpha 1 0%
#8,609 bearing-darwin-arm 1 0%
#8,610 stellar-core 1 0%
#8,611 clean-dev-dirs/clean-dev-dirs/clean-dev-dirs 1 0%
#8,612 lazycontainer 1 0%
#8,613 ki18n 1 0%
#8,614 sz3 1 0%
#8,615 davidchall/hep/apfel++ 1 0%
#8,616 fairrootgroup/fairsoft/fairlogger 1 0%
#8,617 kharliux/tap/autokbisw 1 0%
#8,618 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libcaca --with-rtmpdump --with-speex --with-webp 1 0%
#8,619 octave-app/octave-app/lxqt-build-tools 1 0%
#8,620 mredig/pizza-mcp-tools/mcp-webreader 1 0%
#8,621 git-gui --HEAD 1 0%
#8,622 gollama 1 0%
#8,623 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#8,624 asio --HEAD 1 0%
#8,625 leovoon/tap/slower 1 0%
#8,626 heartbeat 1 0%
#8,627 taihen/tap/dns-benchmark 1 0%
#8,628 govc 1 0%
#8,629 weasyprint 1 0%
#8,630 sqlite --HEAD 1 0%
#8,631 howdoi 1 0%
#8,632 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-glib --with-imagemagick --with-mac-metal --with-starter --with-xwidgets 1 0%
#8,633 jwulff/tap/dictamac 1 0%
#8,634 emmercm/igir/igir --HEAD 1 0%
#8,635 glab-tui 1 0%
#8,636 joe 1 0%
#8,637 sammy007/cryptonight/aeon 1 0%
#8,638 abizer/tap/wtop 1 0%
#8,639 stresstestor/tap/prism-triage 1 0%
#8,640 taskwarrior-tui 1 0%
#8,641 kckylechen1/tachi/tachi 1 0%
#8,642 stormlib 1 0%
#8,643 blogabe/xplanet/xplanet 1 0%
#8,644 hle-world/tap/hle-client 1 0%
#8,645 confluence-markdown-exporter 1 0%
#8,646 oratis/tap/lisa 1 0%
#8,647 eclipse-cj/tap/paper-distill-mcp 1 0%
#8,648 brewsci/bio/iqtree2 1 0%
#8,649 vapoursynth-bs 1 0%
#8,650 leapp-cli 1 0%
#8,651 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libvmaf 1 0%
#8,652 wouterdebie/repo/i2cssh --HEAD 1 0%
#8,653 enapter/tap/enapter 1 0%
#8,654 sgury/localmask/localmask 1 0%
#8,655 harmonybrew/core/simdjson 1 0%
#8,656 roll 1 0%
#8,657 glib-networking 1 0%
#8,658 termshot 1 0%
#8,659 qwwdfsad/tap/hsdis --HEAD 1 0%
#8,660 nyuichi/satysfi/satysfi 1 0%
#8,661 ensembl/external/exonerate09 1 0%
#8,662 zarkdown 1 0%
#8,663 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-libvmaf 1 0%
#8,664 rioriost/tap/celestsp 1 0%
#8,665 svt/avtools/libsvg-proxy-filter 1 0%
#8,666 ginylil/recipes/fon 1 0%
#8,667 dima424658/tap/suscp 1 0%
#8,668 osrf/simulation/ogre2.3 --HEAD 1 0%
#8,669 mcs 1 0%
#8,670 witness 1 0%
#8,671 j-shelfwood/yeet/yeet 1 0%
#8,672 helixml/kodit/kodit 1 0%
#8,673 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid 1 0%
#8,674 pubino/hopen/hopen 1 0%
#8,675 yp583/tap-test/yash-testing-brew 1 0%
#8,676 niklaskorz/setlx/setlx 1 0%
#8,677 osrf/simulation/gz-fuel-tools11 --HEAD 1 0%
#8,678 simo-c3/ccrelay/ccrelay --HEAD 1 0%
#8,679 o6uoq/slidev/slidev 1 0%
#8,680 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --with-native-comp 1 0%
#8,681 cloud-v/icestorm/icestorm --HEAD 1 0%
#8,682 calicoctl 1 0%
#8,683 interstateone/formulae/dump-cookies 1 0%
#8,684 seethruhead/screenorganizer/screen-organizer 1 0%
#8,685 shamrinigor/tap/tart-basic-auth 1 0%
#8,686 montage 1 0%
#8,687 neved4/tap/evry 1 0%
#8,688 kojinakamaru/emacsmacport/emacs-mac@29 1 0%
#8,689 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,690 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-imagemagick --with-xwidgets 1 0%
#8,691 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-imagemagick --with-native-compilation --without-modules 1 0%
#8,692 d12frosted/emacs-plus/emacs-plus@30 --with-savchenkovaleriy-big-sur-curvy-3d-icon 1 0%
#8,693 hlrs-vis/tap/osg2vsg 1 0%
#8,694 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-imagemagick --with-modern-doom3-icon --with-xwidgets 1 0%
#8,695 rayriffy/taps/netcoredbg 1 0%
#8,696 daviderestivo/emacs-head/emacs-head@30 --HEAD --with-cocoa --with-modern-icon-elrumo2 --with-native-full-aot --with-tree-sitter --with-xwidgets 1 0%
#8,697 fava 1 0%
#8,698 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-librist --with-libsoxr --with-libvmaf --with-openssl@3 --with-srt --with-zeromq 1 0%
#8,699 timoheimonen/macos-memory-benchmark/memory-benchmark 1 0%
#8,700 influxdb-cli --HEAD 1 0%
#8,701 bashsenpai/core/senpai-cli 1 0%
#8,702 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libflite --with-libssh --with-libvmaf --with-libxml2 --with-whisper-cpp 1 0%
#8,703 cadence-workflow 1 0%
#8,704 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-doom3-icon --with-native-comp --with-no-frame-refocus --with-xwidgets 1 0%
#8,705 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#8,706 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,707 erlang_ls 1 0%
#8,708 xq 1 0%
#8,709 openvdb --HEAD 1 0%
#8,710 brandonscript/tap/bookpeek 1 0%
#8,711 brewsci/bio/samblaster 1 0%
#8,712 hub --HEAD 1 0%
#8,713 mupdf-tools --HEAD 1 0%
#8,714 macaulay2/tap/lrs 1 0%
#8,715 dimpase/tap/lrcalc 1 0%
#8,716 d235j/ios-restore-tools/libtatsu --HEAD 1 0%
#8,717 ggozad/formulas/oterm 1 0%
#8,718 mimirtool 1 0%
#8,719 homebrew-ffmpeg/ffmpeg/ffmpeg --with-librsvg --with-openh264 --with-rav1e --with-tesseract --with-webp --with-whisper-cpp 1 0%
#8,720 fzzzhan/tap/awake 1 0%
#8,721 homebrew-ffmpeg/ffmpeg/ffmpeg --with-rav1e 1 0%
#8,722 smapi 1 0%
#8,723 dimpase/tap/iml 1 0%
#8,724 robotsandpencils/made/xcodes --HEAD 1 0%
#8,725 pkryger/emacsmacport-exp/emacs-mac-exp@31 --HEAD --with-imagemagick --with-mac-metal --with-modern-icon --with-optimization-flags --with-starter --with-unlimited-select --with-xwidgets 1 0%
#8,726 aconchillo/guile/guile-ncurses --HEAD 1 0%
#8,727 d12frosted/emacs-plus/emacs-plus@29 --with-modern-black-gnu-head-icon --with-native-comp 1 0%
#8,728 h35514n/vim/vim 1 0%
#8,729 scorecard 1 0%
#8,730 overmindtech/overmind/overmind-cli 1 0%
#8,731 lm-sensors 1 0%
#8,732 pingcap/brew/tiup 1 0%
#8,733 mediaarea/mediaarea/avimetaedit-gui 1 0%
#8,734 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,735 filosottile/musl-cross/musl-cross --with-arm --without-aarch64 1 0%
#8,736 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,737 asciidoc --HEAD 1 0%
#8,738 lesserevil/baish/baish 1 0%
#8,739 cava --HEAD 1 0%
#8,740 gnu-indent 1 0%
#8,741 sevenzip --HEAD 1 0%
#8,742 marceljj/tap/audacious-full 1 0%
#8,743 kappa9999/clawshield/clawshield 1 0%
#8,744 libzim 1 0%
#8,745 tecolicom/tap/app-greple-charcode 1 0%
#8,746 pmonclus/sds/sds 1 0%
#8,747 simg2img 1 0%
#8,748 maswag/scientific/symon --HEAD 1 0%
#8,749 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-icon 1 0%
#8,750 hoveradev/formulae/dosbox-x 1 0%
#8,751 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,752 nicholasdille/tap/containerd 1 0%
#8,753 nostorg/nostr/gossip 1 0%
#8,754 harmonybrew/core/qemu 1 0%
#8,755 jaguar 1 0%
#8,756 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libdvdnav --with-libdvdread --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-libxml2 --with-libzvbi --with-opencore-amr --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-speex --with-srt --with-tesseract --with-webp 1 0%
#8,757 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-retro-sink-bw 1 0%
#8,758 stek29/idevice/libusbmuxd 1 0%
#8,759 vishnudas-bluefox/tap/tgplay 1 0%
#8,760 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,761 catppuccin/tap/whiskers 1 0%
#8,762 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-modern-icon --with-native-comp --with-xwidgets 1 0%
#8,763 vinayakkulkarni/deluge-meta/deluge-meta 1 0%
#8,764 zstd --HEAD 1 0%
#8,765 nmrpflash 1 0%
#8,766 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-dbus --with-imagemagick --with-librsvg --with-native-comp --with-xwidgets 1 0%
#8,767 aaratha/emacs-plus/emacs-plus@30 1 0%
#8,768 runme 1 0%
#8,769 harmonybrew/core/extract_url 1 0%
#8,770 thibaultcharr/svg2androidwebp/svg2androidwebp 1 0%
#8,771 danyisill/macfetch/macfetch --HEAD 1 0%
#8,772 libmad-tenacity 1 0%
#8,773 surfer --HEAD 1 0%
#8,774 rfidresearchgroup/proxmark3/proxmark3 --with-generic --without-qt@5 1 0%
#8,775 yusufkaraaslan/skill-seekers/skill-seekers 1 0%
#8,776 dlr-ts/sumo/sumo@1.8.0 1 0%
#8,777 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,778 lgarron/lgarron/thirdparty-oavif --HEAD 1 0%
#8,779 railwaycat/emacsmacport/emacs-mac@29 --with-glib --without-modules 1 0%
#8,780 hhru/tap/codeowner 1 0%
#8,781 hlrs-vis/tap/openinventor --HEAD 1 0%
#8,782 denji/nginx/nginx-full --with-headers-more-module --with-http2 --with-mod-zip-module 1 0%
#8,783 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-native-comp --with-xwidgets 1 0%
#8,784 git-jiro/jiro/gridcoin --with-cli --without-gui --without-upnp 1 0%
#8,785 mistral_vibe 1 0%
#8,786 corrosion 1 0%
#8,787 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-zimg 1 0%
#8,788 sttts/tvniki/tvniki 1 0%
#8,789 ascii-chat 1 0%
#8,790 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libxml2 --with-libzvbi 1 0%
#8,791 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-libzvbi --with-openh264 --with-rav1e --with-srt --with-two-lame --with-xvid 1 0%
#8,792 lifepillar/appleii/merlin32 1 0%
#8,793 wireproxy 1 0%
#8,794 woxi 1 0%
#8,795 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-dbus --with-imagemagick --with-mailutils --with-modern-icon-purple --with-tree-sitter --with-xwidgets 1 0%
#8,796 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-dbus --with-imagemagick --with-mailutils --with-modern-icon-purple --with-xwidgets 1 0%
#8,797 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,798 gss-ntlmssp 1 0%
#8,799 lunarr 1 0%
#8,800 cartr/qt4/openssl@1.0 --with-mips --without-x86_64 1 0%
#8,801 jleivas/mem-cli/mem-cli 1 0%
#8,802 lrzip 1 0%
#8,803 apoorvdarshan/tap/crossposter 1 0%
#8,804 libdill 1 0%
#8,805 gentij/stem-splitter/stem-splitter 1 0%
#8,806 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,807 shivammathur/extensions/gmagick@8.6 1 0%
#8,808 libdnet 1 0%
#8,809 mavryk-network/ligo/ligo@1.8.0 1 0%
#8,810 baobab 1 0%
#8,811 bladeworks-ai/tap/bladeworks 1 0%
#8,812 rene-dev/sigrok/libsigrok --HEAD 1 0%
#8,813 gabriel-c70/claw-coder/claw-coder 1 0%
#8,814 zavora-ai/tap/zavora-cli 1 0%
#8,815 brewsci/bio/blast@2.2 1 0%
#8,816 singular 1 0%
#8,817 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-ggml --with-jpeg-xl --with-librsvg --with-libsoxr --with-libvidstab --with-libzvbi --with-rav1e --with-rubberband --with-tesseract --with-webp --with-whisper-cpp --with-xvid 1 0%
#8,818 brewsci/bio/mpboot 1 0%
#8,819 wouterdebie/repo/locast2tuner 1 0%
#8,820 atlas-brown/tap/try 1 0%
#8,821 bazelisk --HEAD 1 0%
#8,822 danieljustus/tap/symvibe 1 0%
#8,823 oletools 1 0%
#8,824 odil 1 0%
#8,825 kaeus-inc/kovra/kovra 1 0%
#8,826 brewsci/bio/interop 1 0%
#8,827 secapi-ai/tap/secapi 1 0%
#8,828 quantlib 1 0%
#8,829 krishnendu/stratum/stratum-llama-cpp 1 0%
#8,830 penra-corp/tap/condense 1 0%
#8,831 filosottile/musl-cross/musl-cross --with-arm --with-i486 --with-mips --with-mips64 --with-mips64el --with-powerpc --with-powerpc-sf --with-powerpc64le --with-riscv64 1 0%
#8,832 vaibhav-mattoo/cxt/cxt 1 0%
#8,833 x11vnc --HEAD 1 0%
#8,834 bogdan-d/tap/pi-coding-agent 1 0%
#8,835 coinbase/cdpcurl/cdpcurl 1 0%
#8,836 china-drummond/tap/ibattery-mcp 1 0%
#8,837 roktas/tap/sevgi 1 0%
#8,838 abhijit-s/tap/turbo-rag 1 0%
#8,839 defai-digital/ax-engine/ax-engine 1 0%
#8,840 jcgay/jcgay/skyscraper 1 0%
#8,841 finsavvyai/tap/vibevault 1 0%
#8,842 openhmd --HEAD 1 0%
#8,843 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libmodplug --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-rubberband --with-two-lame --with-webp --with-xvid --with-zimg 1 0%
#8,844 cardano-conf 1 0%
#8,845 calmcrow/lanchat/lanchat 1 0%
#8,846 desdaemon/repo/flutter_rust_bridge_codegen 1 0%
#8,847 mimium-org/mimium/mimium 1 0%
#8,848 yann-r/canettes/eclipse-clp@6 1 0%
#8,849 khr898/ntfsmac/ntfsmac 1 0%
#8,850 btcli --HEAD 1 0%
#8,851 sirserje/zkast/zkast 1 0%
#8,852 spinlocklabs/vulkan/molten-vk 1 0%
#8,853 paperfoot/tap/aiseo 1 0%
#8,854 martingross/tap/calbuddy 1 0%
#8,855 cxwx/cxbrew/pf 1 0%
#8,856 glassflow/tap/tares 1 0%
#8,857 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-elmerice 1 0%
#8,858 jetstack/jetstack/paranoia 1 0%
#8,859 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#8,860 milesbuckton/qemu-virgl/libangle 1 0%
#8,861 ykarakoti77/musicd/musicd 1 0%
#8,862 vapoursynth-vszip 1 0%
#8,863 erg 1 0%
#8,864 gpg-tui 1 0%
#8,865 brewsci/bio/bali-phy 1 0%
#8,866 brewsci/bio/manta 1 0%
#8,867 fstab/oniguruma/oniguruma-5.9.6 1 0%
#8,868 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-mac-metal --with-native-comp --with-natural-title-bar --with-starter 1 0%
#8,869 micktwomey/notions/notions 1 0%
#8,870 amber-lang/amber/amber-lang 1 0%
#8,871 freecad/freecad/nglib@6.2.2105 --HEAD 1 0%
#8,872 hokix/legacy/cmake@3.20.0 1 0%
#8,873 star 1 0%
#8,874 gocryptfs 1 0%
#8,875 raw-packet/raw-packet/raw-packet 1 0%
#8,876 qcoro 1 0%
#8,877 ettercap 1 0%
#8,878 shivammathur/php/php@8.3.8 1 0%
#8,879 cf-terraforming 1 0%
#8,880 rattatap/tap/bind-dnstools 1 0%
#8,881 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-mailutils --with-no-frame-refocus --with-xwidgets 1 0%
#8,882 unpaper 1 0%
#8,883 rdump/versions/kubernetes-cli@1.18.8 1 0%
#8,884 helm --HEAD 1 0%
#8,885 imapfilter 1 0%
#8,886 crimson-knight/tap/engram 1 0%
#8,887 harmonybrew/core/ffmpeg 1 0%
#8,888 bramstein/webfonttools/woff2 1 0%
#8,889 jrmastermodelbuilder/libming/libming-stable 1 0%
#8,890 akisonlyforu/contextferry/contextferry 1 0%
#8,891 forcequitos/brew/discaps 1 0%
#8,892 libar2 1 0%
#8,893 scaryrawr/formulae/omlx --HEAD --with-audio --with-grammar --with-image 1 0%
#8,894 vybestack/tap/llxprt-code 1 0%
#8,895 jakob-bagterp/timer-for-python/timer-for-python 1 0%
#8,896 sanford/tap/lsnet 1 0%
#8,897 jcpsimmons/tap/ponysay-rust 1 0%
#8,898 theory/sqitch/sqitch 1 0%
#8,899 kwctl 1 0%
#8,900 libsolv 1 0%
#8,901 poppler-qt6 1 0%
#8,902 pixie 1 0%
#8,903 kamiwaza-ai/kamiwaza/kamiwaza 1 0%
#8,904 graphene 1 0%
#8,905 alceal/tap/reddit-cli 1 0%
#8,906 mediaarea/mediaarea/mediainfo-gui 1 0%
#8,907 synergy-core --HEAD 1 0%
#8,908 puleeno/openlitespeed/lsphp81 1 0%
#8,909 chroncal 1 0%
#8,910 dpep/tools/ae 1 0%
#8,911 gtasks-md --HEAD 1 0%
#8,912 dynaconf 1 0%
#8,913 gundam-organization/tap/gundam --HEAD 1 0%
#8,914 miista/happier/happier 1 0%
#8,915 trino 1 0%
#8,916 aqua 1 0%
#8,917 linux-noah/noah/noah --HEAD 1 0%
#8,918 jpipe-mcscert/mcscert/jpipe-runner 1 0%
#8,919 jessecu2024/tap/imail 1 0%
#8,920 eigenpy 1 0%
#8,921 kgruel/siftd/siftd 1 0%
#8,922 chrihop/gcc_cross_compilers/i686-elf-binutils 1 0%
#8,923 mukundakatta/tools/agent-budget 1 0%
#8,924 xml2rfc 1 0%
#8,925 youtube-dl 1 0%
#8,926 po4a --HEAD 1 0%
#8,927 shibudb 1 0%
#8,928 pear 1 0%
#8,929 somalier 1 0%
#8,930 gettext --HEAD 1 0%
#8,931 barronlroth/tap/f1-cli 1 0%
#8,932 adv3nt3/tap/apple-docs-mcp 1 0%
#8,933 brewsci/bio/andi 1 0%
#8,934 oasis-main/dot-swarm/dot-swarm 1 0%
#8,935 madhavsuresh/rmsync/rmsync 1 0%
#8,936 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jpeg-xl --with-libbluray --with-libvmaf --with-webp 1 0%
#8,937 apesdk 1 0%
#8,938 stricaud/tap/libpcapng 1 0%
#8,939 calmcrow/formulae/winghexexplorer2 --HEAD 1 0%
#8,940 vacuum 1 0%
#8,941 mqttui 1 0%
#8,942 choragus 1 0%
#8,943 qtdatavis3d --HEAD 1 0%
#8,944 mail-deduplicate 1 0%
#8,945 qtquicktimeline --HEAD 1 0%
#8,946 nself-org/nself/nself 1 0%
#8,947 lizardbyte/homebrew/sunshine-beta --with-cuda --without-static-boost 1 0%
#8,948 thedoublejay/tap/gather-step 1 0%
#8,949 brewsci/bio/exonerate 1 0%
#8,950 omnigres/omnigres/pg_yregress 1 0%
#8,951 codex-acp --HEAD 1 0%
#8,952 attheodo/formulae/wifimon 1 0%
#8,953 pyenv-virtualenv --HEAD 1 0%
#8,954 alecfeeman/sigil/sigil 1 0%
#8,955 vim --HEAD 1 0%
#8,956 abtop 1 0%
#8,957 osrf/simulation/gz-rotary-utils --HEAD 1 0%
#8,958 osrf/simulation/gz-rotary-math --HEAD 1 0%
#8,959 krodak/tap/pl-agent-skills --HEAD 1 0%
#8,960 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,961 shadowsx3/tools/libusbmuxd-wifi 1 0%
#8,962 moshebe/pkg/transcribeer 1 0%
#8,963 cawaltrip/tap/onelogin-aws-cli 1 0%
#8,964 libkrun/krun/virglrenderer 1 0%
#8,965 mpernia/mcleaner/mcleaner 1 0%
#8,966 mandown 1 0%
#8,967 porter 1 0%
#8,968 maximbilan/ramjet/ramjet 1 0%
#8,969 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-fdk-aac --with-ggml --with-jpeg-xl --with-libplacebo --with-librist --with-libsoxr --with-libvidstab --with-libvmaf --with-opencore-amr --with-openh264 --with-openjpeg --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 1 0%
#8,970 wallichinz/tap/leetbrew 1 0%
#8,971 oco-adam/tap/theda 1 0%
#8,972 codemaster-ar/aurora/aurora-bioscience 1 0%
#8,973 bl4cc4t/vsplugins/vsp-deblock --HEAD 1 0%
#8,974 neolunar7/tap/multiclock 1 0%
#8,975 nom 1 0%
#8,976 jj-spice 1 0%
#8,977 crowdsec 1 0%
#8,978 links 1 0%
#8,979 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,980 exim 1 0%
#8,981 macaulay2/tap/palp 1 0%
#8,982 umars28/tap/sshm --HEAD 1 0%
#8,983 zhongruoyu/tap/owe 1 0%
#8,984 cairo --HEAD 1 0%
#8,985 yanirclsr/tap/acum-mcp 1 0%
#8,986 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-ggml --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#8,987 harmonybrew/core/atomcode 1 0%
#8,988 rescenedev/tap/alldoc 1 0%
#8,989 yozlog/tap/dragterm 1 0%
#8,990 satyam12singh/tap/repolens 1 0%
#8,991 mullassery/tap/prismnote 1 0%
#8,992 weirdo-adam/tap/issue-jumper 1 0%
#8,993 crimson-knight/amber-v2/amber-v2 --HEAD 1 0%
#8,994 pipx --HEAD 1 0%
#8,995 xavs2 1 0%
#8,996 afawe3331/macaudiotools/macaudiotools 1 0%
#8,997 hexo 1 0%
#8,998 d12frosted/emacs-plus/emacs-plus@30 --with-modern-cg433n-icon --with-xwidgets 1 0%
#8,999 denvig/tap/denvig 1 0%
#9,000 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-natural-title-bar --with-starter 1 0%
#9,001 apt 1 0%
#9,002 nvc 1 0%
#9,003 cyclonedx-cli 1 0%
#9,004 dvdauthor 1 0%
#9,005 icankeep/diffview/diffview 1 0%
#9,006 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-native-comp --with-native-full-aot --with-no-frame-refocus --with-pdumper --with-tree-sitter --with-xwidgets 1 0%
#9,007 cyperx84/tap/remotion-claw 1 0%
#9,008 bear --HEAD 1 0%
#9,009 life2you/tap/codexsmtui 1 0%
#9,010 mclucy/tap/lucy --HEAD 1 0%
#9,011 caligraltd/tap/asdbctl 1 0%
#9,012 paul-nameless/repo/tg 1 0%
#9,013 kbisla9/tap/knowledge-tree 1 0%
#9,014 vbcherepanov/tap/total-memory 1 0%
#9,015 cxwx/cxbrew/cargo-ui 1 0%
#9,016 kriomant/tap/pipec 1 0%
#9,017 sidneys/homebrew/mkvtoolnix 1 0%
#9,018 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libzvbi --with-openssl 1 0%
#9,019 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-ctags --with-debug --with-imagemagick --with-mailutils --with-xwidgets 1 0%
#9,020 feishu2md --HEAD 1 0%
#9,021 homebrew-ffmpeg/ffmpeg/ffmpeg --with-jpeg-xl --with-libflite --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-libxml2 --with-openh264 --with-openjpeg --with-rubberband --with-srt --with-webp --with-zeromq --with-zimg 1 0%
#9,022 lzlib 1 0%
#9,023 iamfat/tap/rkdeveloptool 1 0%
#9,024 doxygen --without-geoip 1 0%
#9,025 denji/nginx/nginx-full --with-tcp-proxy-module 1 0%
#9,026 sauravgit/agentdyno/agentdyno 1 0%
#9,027 qtwebsockets --HEAD 1 0%
#9,028 eso/pipelines/esopipe-nirps 1 0%
#9,029 kreuzberg-dev/tap/kreuzcrawl 1 0%
#9,030 php@8.5 1 0%
#9,031 dartsim/dart/fcl04 1 0%
#9,032 kylefmohr/ceph-client/ceph-client 1 0%
#9,033 ncnn 1 0%
#9,034 mdcat --HEAD 1 0%
#9,035 jhalter/mobius-hotline-client/mobius-hotline-client 1 0%
#9,036 fclones 1 0%
#9,037 libmodplug 1 0%
#9,038 harmonybrew/core/libomp 1 0%
#9,039 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,040 trebuhs/tap/asa-cli 1 0%
#9,041 dash-mpd-cli 1 0%
#9,042 harmonybrew/core/bmake 1 0%
#9,043 assimp@5 1 0%
#9,044 bgigurtsis/klaus/klaus 1 0%
#9,045 scale2x 1 0%
#9,046 d12frosted/emacs-plus/emacs-plus@30 --with-c9rgreen-sonoma-icon --with-imagemagick 1 0%
#9,047 okeanos/tap/blesh 1 0%
#9,048 catcatcatcatcatcatcatcatcatcat/tap/squeezy 1 0%
#9,049 mdave/nektar/tinyxml 1 0%
#9,050 aaratha/emacs-plus/emacs-plus@31 --with-native-comp --with-no-frame-refocus 1 0%
#9,051 bigbes/tap/bw-serve --HEAD 1 0%
#9,052 bigbes/tap/claudio 1 0%
#9,053 brewsci/num/brewsci-mumps --with-brewsci-scotch 1 0%
#9,054 discordchatexporter 1 0%
#9,055 tzvetkoff/php54/phpsh 1 0%
#9,056 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,057 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-imagemagick --with-xwidgets 1 0%
#9,058 boringsql/boringsql/fixturize 1 0%
#9,059 gum97/tap/cli-screenshot 1 0%
#9,060 kmilner/tap/libbuddy 1 0%
#9,061 cockroach-eater/tap/lazyjira --HEAD 1 0%
#9,062 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark --with-generic --with-hf-legicsim 1 0%
#9,063 biaojiang/mdviewer/mdviewer 1 0%
#9,064 mac1010z/tools/tapo-cli 1 0%
#9,065 buku 1 0%
#9,066 hg-fast-export 1 0%
#9,067 ykman --HEAD 1 0%
#9,068 openjdk --HEAD 1 0%
#9,069 tkjaer/tap/etr 1 0%
#9,070 harmonybrew/core/findutils 1 0%
#9,071 fairrootgroup/fairsoft/fairsoft@22.11 1 0%
#9,072 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libopenmpt --with-libplacebo --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 1 0%
#9,073 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-libssh --with-libvmaf --with-tesseract 1 0%
#9,074 zalun/grostat/grostat 1 0%
#9,075 lgarron/lgarron/appiconify --HEAD 1 0%
#9,076 railwaycat/emacsmacport/emacs-mac@29 --without-tree-sitter 1 0%
#9,077 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-sexy-icon --with-glib --with-imagemagick --with-librsvg --with-modern-icon --with-native-comp --with-native-compilation --with-natural-title-bar --with-starter --with-unlimited-select --with-xwidgets 1 0%
#9,078 kylefeng28/core/rvvm --HEAD 1 0%
#9,079 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-no-frame-refocus --with-spacemacs-icon 1 0%
#9,080 github-markdown-toc 1 0%
#9,081 fulviofreitas/eeroctl/eeroctl 1 0%
#9,082 protobuf@25.3 1 0%
#9,083 gwerbin/tap/neovim-qt 1 0%
#9,084 jfb3615/repo/qt 1 0%
#9,085 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jack --with-libssh --with-rtmpdump --with-srt --with-webp 1 0%
#9,086 d12frosted/emacs-plus/emacs-plus@29 --with-modern-sjrmanning-icon --with-native-comp 1 0%
#9,087 bazelbuild/tap/bazel@8.5.1 1 0%
#9,088 chigraph/kf5/kf5-extra-cmake-modules 1 0%
#9,089 sidneys/homebrew/openssl@1.0 --with-fdk-aac --with-libplacebo --with-libsoxr --with-libvmaf 1 0%
#9,090 st3v3nmw/tap/sourcerer 1 0%
#9,091 wasmcloud/wasmcloud/wasmcloud 1 0%
#9,092 ta7mid/tap/globalarrays 1 0%
#9,093 zeroclaw --HEAD 1 0%
#9,094 fastmcp 1 0%
#9,095 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-icons-project-EmacsIcon7 --with-mac-metal --with-native-comp --with-starter 1 0%
#9,096 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,097 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-ctags --with-dbus --with-debug 1 0%
#9,098 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-modern-vscode-icon 1 0%
#9,099 eloitor/implicitcad/implicitcad 1 0%
#9,100 dzirtusss/tap/karules 1 0%
#9,101 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-starter --with-xwidgets --without-modules 1 0%
#9,102 hannah-computer/cblite/cblite@4 1 0%
#9,103 tchoupinax/brew/pjf 1 0%
#9,104 instantclienttap/instantclient/instantclient-tools 1 0%
#9,105 collioud/imager/imager 1 0%
#9,106 jaman21/virt-manager/virt-viewer 1 0%
#9,107 freecad/freecad/med-file@4.1.1 1 0%
#9,108 jmoney/teleport/teleport@3.1 1 0%
#9,109 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libflite --with-librsvg --with-libsoxr --with-libssh --with-libxml2 --with-opencore-amr --with-openh264 --with-openssl --with-two-lame --with-webp 1 0%
#9,110 quilldev/tap/nako 1 0%
#9,111 thobai/voice2text/voice2text 1 0%
#9,112 rogpld/emacs-head/emacs-head@31 --with-cocoa 1 0%
#9,113 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-native-compilation --with-natural-title-bar 1 0%
#9,114 python@3.15 --with-postgres-support --with-sqlite-support 1 0%
#9,115 progressline 1 0%
#9,116 tiennesdm/vedadb/vedadb 1 0%
#9,117 cpptrace 1 0%
#9,118 qtdeclarative --HEAD 1 0%
#9,119 menci/libvirt-m1/gtk-vnc 1 0%
#9,120 shivammathur/extensions/pdo_firebird@8.4 1 0%
#9,121 rakshithgoud453/tap/termcall 1 0%
#9,122 digitalspacestdio/php/php85-mongodb 1 0%
#9,123 merenkoff/arj/arj 1 0%
#9,124 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-librsvg --with-native-comp 1 0%
#9,125 paperfoot/tap/contract 1 0%
#9,126 octave-app/octave-app/octave-octapp@9.4.0 1 0%
#9,127 cxwx/cxbrew/flashlight --HEAD 1 0%
#9,128 delvinwang-inno/esa-tui/esa-tui 1 0%
#9,129 gitlogue 1 0%
#9,130 camlpdf 1 0%
#9,131 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick 1 0%
#9,132 tun2proxy 1 0%
#9,133 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,134 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-srt --with-webp 1 0%
#9,135 imaresss/assemble/assemble 1 0%
#9,136 open-cobol-esql 1 0%
#9,137 dickwu/tap/html-pdf 1 0%
#9,138 xz --HEAD 1 0%
#9,139 shivammathur/extensions/pdo_firebird@8.5 1 0%
#9,140 homebrew-ffmpeg/ffmpeg/ffmpeg --with-cairo --with-dvd --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,141 linkuistics/taps/testanyware 1 0%
#9,142 irt-open-source/nga/libbw64 1 0%
#9,143 ospray --HEAD 1 0%
#9,144 oscarvarto/jank/jank-git 1 0%
#9,145 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-retro-gnu-meditate-levitate-icon --with-xwidgets 1 0%
#9,146 authzed/tap/zed --HEAD 1 0%
#9,147 techwizrd/tap/tapcue 1 0%
#9,148 tecolicom/tap/app-lms --HEAD 1 0%
#9,149 demogorgon314/mat-cli/mat-cli 1 0%
#9,150 d12frosted/emacs-plus/emacs-plus@31 --with-dragon-icon --with-imagemagick 1 0%
#9,151 tenace/toybrew/toybrew 1 0%
#9,152 theory/sqitch/sqitch --with-postgres-support 1 0%
#9,153 rodmena-limited/tap/retunnel 1 0%
#9,154 rmrfrs 1 0%
#9,155 bdmackie/specci/specci-dev 1 0%
#9,156 dblatex 1 0%
#9,157 shivammathur/php/php@8.2.26 1 0%
#9,158 qtconnectivity --HEAD 1 0%
#9,159 yap --HEAD 1 0%
#9,160 shivammathur/php/php@8.5-experimental 1 0%
#9,161 gpsbabel 1 0%
#9,162 indilib/indi/libqhy 1 0%
#9,163 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libzvbi --with-srt --with-tesseract 1 0%
#9,164 jenrzzz/formulae/focusrelay-api 1 0%
#9,165 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libr3d --with-libvmaf --with-openjpeg --with-srt 1 0%
#9,166 gaberealb/psx-dev/mips-linux-gnu-binutils 1 0%
#9,167 chenrui333/tap/bytebox 1 0%
#9,168 dnscontrol 1 0%
#9,169 damsleth/tap/cognitive-ledger 1 0%
#9,170 gogo 1 0%
#9,171 mileson/cjfcodexswitcher/cjfcodexswitcher 1 0%
#9,172 timescale/tap/timescaledb-toolkit --HEAD 1 0%
#9,173 itsnauman/yfy/yfy 1 0%
#9,174 xonsh 1 0%
#9,175 ouch 1 0%
#9,176 danielbair/tap/python@2 1 0%
#9,177 hlrs-vis/tap/libe57 1 0%
#9,178 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,179 celsiusnarhwal/htt/rm-trash 1 0%
#9,180 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-icons-project-EmacsIcon7 --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-starter --with-xwidgets --without-modules 1 0%
#9,181 bourgonlaurent/inf1900-tools/serieviausb 1 0%
#9,182 railwaycat/emacsmacport/emacs-mac@29 --with-starter --without-modules 1 0%
#9,183 ensembl/ensembl/clapack 1 0%
#9,184 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libplacebo --with-libvmaf --with-libxml2 --with-rav1e --with-svt-av1 --with-webp 1 0%
#9,185 octave-app/octave-app/octave@9.1.0 1 0%
#9,186 coin3d 1 0%
#9,187 kionsoftware/tap/kion-cli --HEAD 1 0%
#9,188 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-icons-project-EmacsIcon1 --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-natural-title-bar --with-starter 1 0%
#9,189 lizardbyte/homebrew/cuda@13.1 1 0%
#9,190 denji/nginx/nginx-full --with-eval-module --with-geoip2-module --with-http2 --with-http3 --with-image-filter --with-rtmp-module --with-slice --with-status --with-stream --with-stream-ssl --with-stream-ssl-preread --with-unzip-module --with-upload-module --with-upload-progress-module --with-upstream-check-module --with-vod-module --with-websockify-module --with-xslt 1 0%
#9,191 pystring 1 0%
#9,192 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-imagemagick --with-mailutils --with-xwidgets 1 0%
#9,193 rockorager/tap/prise --with-imagemagick 1 0%
#9,194 gotags 1 0%
#9,195 tarantool/tap/tarantool@2.5 1 0%
#9,196 chicken --HEAD 1 0%
#9,197 twam/openfpga/nextpnr --with-gui --without-arch-ecp5 1 0%
#9,198 wasm-pack 1 0%
#9,199 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-elrumo2-icon --with-imagemagick --with-mailutils --with-modern-icon --with-no-frame-refocus --with-xwidgets 1 0%
#9,200 caddy-dev 1 0%
#9,201 tulilirockz/bcvk/bcvk --HEAD 1 0%
#9,202 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark --with-hf-legicsim 1 0%
#9,203 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-native-compilation --with-no-title-bars 1 0%
#9,204 atoll6/rivalcfg/rivalcfg 1 0%
#9,205 abcde --HEAD 1 0%
#9,206 dylibbundler --HEAD 1 0%
#9,207 harfbuzz --HEAD 1 0%
#9,208 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-big-sur-icon --with-imagemagick --with-mac-metal --with-native-comp 1 0%
#9,209 pgrouting 1 0%
#9,210 abinit/tap/abinit --with-testsuite 1 0%
#9,211 ublue-os/experimental-tap/bluefin-cli --HEAD 1 0%
#9,212 gf 1 0%
#9,213 twitch-cli 1 0%
#9,214 arustydev/tap/flameshow 1 0%
#9,215 arustydev/tap/ktool 1 0%
#9,216 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,217 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-mailutils 1 0%
#9,218 llvm --with-modern-icon 1 0%
#9,219 px4/px4/fastddsgen 1 0%
#9,220 macosvpn 1 0%
#9,221 looooonk/tap/jsonl-cli 1 0%
#9,222 ufdup89/custom/premake 1 0%
#9,223 icu4c 1 0%
#9,224 theapplegates/kleopatra6mac/kf6-breeze-icons 1 0%
#9,225 diffedit3 1 0%
#9,226 macaulay2/tap/cohomcalg 1 0%
#9,227 computelesscomputer/johnjeong/johnjeong 1 0%
#9,228 dgilperez/tap/sure-cli 1 0%
#9,229 imhansai/tool/smali 1 0%
#9,230 farmerchris/tap/butt 1 0%
#9,231 d12frosted/emacs-plus/emacs-plus@30 --with-spacemacs-icon --with-xwidgets 1 0%
#9,232 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-native-comp --with-unlimited-select 1 0%
#9,233 lgarron/lgarron/web --HEAD 1 0%
#9,234 shivammathur/extensions/seaslog@8.1 1 0%
#9,235 gromgit/tap/ffmpeg@8.cuda 1 0%
#9,236 cielavenir/ciel/test-gcc 1 0%
#9,237 atsushieno/oss/midicci 1 0%
#9,238 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-dbus --with-emacs-big-sur-icon --with-glib --with-librsvg --with-native-comp --with-natural-title-bar --with-starter 1 0%
#9,239 sanjeev-/beehive/beehive 1 0%
#9,240 rakudeji/dbtx/dbtx 1 0%
#9,241 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-imagemagick --with-mailutils --with-xwidgets 1 0%
#9,242 yukaii/tap/tsm 1 0%
#9,243 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-debug --with-mailutils --with-xwidgets 1 0%
#9,244 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --with-native-compilation --with-natural-title-bar 1 0%
#9,245 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,246 osrf/simulation/ignition-transport11 1 0%
#9,247 homebrew-zathura/zathura/girara --HEAD 1 0%
#9,248 localstack 1 0%
#9,249 programmerin-wonderland/raff/kf5-ki18n --HEAD 1 0%
#9,250 railwaycat/emacsmacport/emacs-mac --with-natural-title-bar 1 0%
#9,251 siliconwitchery/oss-fpga/icestorm --HEAD 1 0%
#9,252 ruby-lsp --HEAD 1 0%
#9,253 caius/tap/amp-code 1 0%
#9,254 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-librist --with-libvidstab --with-libvmaf --with-openssl --with-srt --with-zeromq --with-zimg 1 0%
#9,255 brewsci/num/brewsci-superlu-dist 1 0%
#9,256 ysoftwareab/tap/erlang 1 0%
#9,257 static-web-server 1 0%
#9,258 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-ggml --with-jack --with-libssh --with-libvmaf --with-libxml2 --with-libzvbi --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rtmpdump --with-srt --with-webp 1 0%
#9,259 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-imagemagick --with-mailutils --with-xwidgets 1 0%
#9,260 gemini-cli@0.29.0 1 0%
#9,261 dune3d 1 0%
#9,262 ipmitool --HEAD 1 0%
#9,263 shivammathur/php/php@8.2-debug 1 0%
#9,264 happy-coder 1 0%
#9,265 cdebug 1 0%
#9,266 codemaster-ar/ai-cli/ai-cli 1 0%
#9,267 akkeshavan/first/first-compiler --HEAD 1 0%
#9,268 adtennant/tilengine/tilengine --HEAD 1 0%
#9,269 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libssh --with-openvino --with-tensorflow 1 0%
#9,270 hindent 1 0%
#9,271 grpc@1.51.1 1 0%
#9,272 txr 1 0%
#9,273 zig --HEAD 1 0%
#9,274 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-debug --with-imagemagick --with-mailutils --with-xwidgets 1 0%
#9,275 dunglas/frankenphp/frankenphp --HEAD 1 0%
#9,276 iotexproject/ioctl-unstable/ioctl-unstable 1 0%
#9,277 xo/xo/usql --HEAD --with-odbc 1 0%
#9,278 amiaopensource/amiaos/qctparse 1 0%
#9,279 mtr --HEAD 1 0%
#9,280 loopwork/tap/olleh 1 0%
#9,281 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,282 d12frosted/emacs-plus/emacs-plus@30 --with-elrumo2-icon --with-imagemagick --with-xwidgets 1 0%
#9,283 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-rav1e 1 0%
#9,284 argocd-vault-plugin 1 0%
#9,285 librtprocess 1 0%
#9,286 aiquotabar 1 0%
#9,287 vint 1 0%
#9,288 openmsx --HEAD 1 0%
#9,289 libproxy 1 0%
#9,290 maturin --HEAD 1 0%
#9,291 mrkyr/corali/covertagger --HEAD 1 0%
#9,292 fbkarsdorp/lamachine/ucto 1 0%
#9,293 fbkarsdorp/lamachine/libexttextcat 1 0%
#9,294 funcman/custom-formulas/stm8flash 1 0%
#9,295 asimov-modules/tap/asimov-whatsapp-module 1 0%
#9,296 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-jpeg-xl --with-libbluray --with-librsvg --with-xvid 1 0%
#9,297 homebrew-zathura/zathura/zathura-cb 1 0%
#9,298 riscv-software-src/riscv/riscv-isa-sim 1 0%
#9,299 cozyhr 1 0%
#9,300 soum-takuya/tap-hpcidev/jwt-agent 1 0%
#9,301 zola 1 0%
#9,302 csyezheng/tap/a2fa 1 0%
#9,303 denji/nginx/nginx-full --with-accept-language-module --with-accesskey-module --with-addition --with-ajp-module --with-anti-ddos-module --with-array-var-module --with-auth-digest-module --with-auth-ldap-module --with-auth-pam-module --with-auth-req --with-auto-keepalive-module --with-autols-module --with-brotli-module --with-cache-purge-module --with-captcha-module --with-dav-ext-module --with-debug --with-degredation --with-dosdetector-module --with-echo-module --with-eval-module --with-fancyindex-module --with-flv --with-gd --with-google-perftools --with-gperftools --with-gunzip --with-gzip-static --with-headers-more-module --with-healthcheck-module --with-homebrew-libressl --with-http-accounting-module --with-http-flood-detector-module --with-http-remote-passwd-module --with-http2 --with-http3 --with-image-filter --with-imlib2 --with-log-if-module --with-lua-module --with-mail --with-mail-ssl --with-mod-zip-module --with-mp4 --with-mp4-h264-module --with-mruby-module --with-naxsi-module --with-nchan-module --with-njs-module --with-notice-module --with-passenger --with-pcre-jit --with-perl --with-php-session-module --with-push-stream-module --with-random-index --with-realip --with-realtime-req-module --with-redis-module --with-redis2-module --with-rtmp-module --with-secure-link --with-set-misc-module --with-slice --with-small-light-module --with-status --with-stream --with-stream-geoip --with-stream-realip --with-stream-ssl --with-stream-ssl-preread --with-sub --with-subs-filter-module --with-tcp-proxy-module --with-txid-module --with-unzip-module --with-upload-module --with-upload-progress-module --with-ustats-module --with-var-req-speed-module --with-vod-module --with-vts-module --with-webdav --with-websockify-module --with-xslt --with-xsltproc-module 1 0%
#9,304 anarchivist/hamradio/direwolf --HEAD 1 0%
#9,305 shivammathur/extensions/mongodb@8.5 1 0%
#9,306 shipsoftwareai/tap/code-mechanic 1 0%
#9,307 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-ggml --with-jpeg-xl --with-libbluray --with-libopenmpt --with-libplacebo --with-libzvbi --with-srt --with-whisper-cpp --with-zimg 1 0%
#9,308 readwise-cli 1 0%
#9,309 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-spacemacs-icon 1 0%
#9,310 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-dbus --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-spacemacs-icon --with-starter --with-unlimited-select --with-xwidgets 1 0%
#9,311 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libbluray --with-librsvg --with-libsoxr --with-libxml2 --with-openjpeg --with-openssl --with-rav1e --with-srt --with-svt-av1 --with-tesseract --with-webp 1 0%
#9,312 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-alecive-flatwoken-icon 1 0%
#9,313 simo-ship-it/aurora/aurora 1 0%
#9,314 cyphernetes 1 0%
#9,315 walavave/tap/trash-cli 1 0%
#9,316 brewsci/science/t-coffee 1 0%
#9,317 kushagra1212/flowwing/flowwing 1 0%
#9,318 mahoney/tap/docker-lifecycle-listener 1 0%
#9,319 admk/formulae/sketchybar 1 0%
#9,320 austron24/alpha-cli/alpha-cli 1 0%
#9,321 crawdaddie/yalce/yalce 1 0%
#9,322 sidekick 1 0%
#9,323 bbftp-client 1 0%
#9,324 zoharbabin/due-diligence-agents/dd-agents 1 0%
#9,325 e2tools 1 0%
#9,326 openiked 1 0%
#9,327 dbg-macro 1 0%
#9,328 gcem 1 0%
#9,329 adrianmross/tap/trading-bot 1 0%
#9,330 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libbluray --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-xvid 1 0%
#9,331 perlbrew 1 0%
#9,332 frps 1 0%
#9,333 idleberg/nsisbi/nsisbi@3.02.1.2 1 0%
#9,334 beanquery 1 0%
#9,335 clanzhang/tap/snip 1 0%
#9,336 akira-toriyama/tap/facet --HEAD 1 0%
#9,337 papa-channy/tap/gdrive-organizer 1 0%
#9,338 dlr-ts/sumo/sumo@1.2.0 1 0%
#9,339 neved4/tap/dgen 1 0%
#9,340 hsorbo/tap/ntfs-3g 1 0%
#9,341 popt 1 0%
#9,342 rmpc 1 0%
#9,343 mp3val 1 0%
#9,344 chenrui333/tap/firm 1 0%
#9,345 wbrackenbury/seventeenlands/seventeenlands 1 0%
#9,346 trustify 1 0%
#9,347 sirhc/tap/hledger-textual 1 0%
#9,348 hyduan/tap/deepseek-harness 1 0%
#9,349 gcsfuse 1 0%
#9,350 aktoriukas/tap/agentch 1 0%
#9,351 brewsci/science/swarm 1 0%
#9,352 brewsci/science/soplex 1 0%
#9,353 brewsci/science/shark 1 0%
#9,354 brewsci/science/scrm 1 0%
#9,355 brewsci/science/scram 1 0%
#9,356 brewsci/science/ray 1 0%
#9,357 shivammathur/extensions/xdebug@7.4 1 0%
#9,358 brewsci/science/mantaflow 1 0%
#9,359 gershnik/repo/eg-wakeonlan 1 0%
#9,360 brewsci/science/lumpy-sv 1 0%
#9,361 brewsci/science/lsd 1 0%
#9,362 brewsci/science/cube 1 0%
#9,363 signalwire/signalwire/spandsp 1 0%
#9,364 minizip-ng --HEAD 1 0%
#9,365 riscv-software-src/riscv/riscv-pk 1 0%
#9,366 moves-rwth/storm/stormchecker --with-spot 1 0%
#9,367 davidchall/hep/rivet 1 0%
#9,368 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-openh264 --with-openjpeg --with-rav1e 1 0%
#9,369 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-openh264 --with-rav1e --with-webp 1 0%
#9,370 ktnjared/ktnjared/qopy 1 0%
#9,371 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-jpeg-xl --with-openh264 --with-openjpeg --with-rav1e --with-webp 1 0%
#9,372 davidchall/hep/hepmc2 1 0%
#9,373 tinycomputer-io/tap/tinynote 1 0%
#9,374 packcc 1 0%
#9,375 asdf-format/tap/sourcextractor-asdf 1 0%
#9,376 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-native-comp --with-xwidgets 1 0%
#9,377 adeministratorr/tap/ude-mac-arm64 1 0%
#9,378 harmonybrew/core/rpcsvc-proto 1 0%
#9,379 adeministratorr/tap/edevlet-eimza 1 0%
#9,380 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libopenmpt --with-libzvbi 1 0%
#9,381 snownews 1 0%
#9,382 wild 1 0%
#9,383 libiodbc 1 0%
#9,384 sidaf/pentest/wpscan 1 0%
#9,385 shivammathur/extensions/pinba@8.2 1 0%
#9,386 macaulay2/tap/macaulay2 --without-python 1 0%
#9,387 willyv3/tap/gummy-agent 1 0%
#9,388 buckleypaul/tap/zmkonfig 1 0%
#9,389 jydu/biopp/libbpp-seq 1 0%
#9,390 rust-script 1 0%
#9,391 willyv3/tap/distributed 1 0%
#9,392 oxvg 1 0%
#9,393 sqldef/sqldef/mysqldef --HEAD 1 0%
#9,394 yun-sangho/tap/dedrm 1 0%
#9,395 shivammathur/extensions/v8js@8.4 1 0%
#9,396 goaccess 1 0%
#9,397 joelpeckham/ocrogram/ocrogram --HEAD 1 0%
#9,398 zoltanf/rc0/rc0 1 0%
#9,399 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-debug --with-imagemagick --with-xwidgets 1 0%
#9,400 qtcharts 1 0%
#9,401 faad2 1 0%
#9,402 rammap 1 0%
#9,403 xml-tooling-c 1 0%
#9,404 dmshvedchenko/tui-calendar/tui-calendar 1 0%
#9,405 qpid-proton 1 0%
#9,406 sofia-sip 1 0%
#9,407 gmic --HEAD 1 0%
#9,408 harmonybrew/core/pax 1 0%
#9,409 cargo-generate 1 0%
#9,410 nco 1 0%
#9,411 magikrun/magikpod/magikpod 1 0%
#9,412 mysql --HEAD 1 0%
#9,413 d235j/ios-restore-tools/img4tool --HEAD 1 0%
#9,414 siliconwitchery/oss-fpga/project-trellis --HEAD 1 0%
#9,415 pkryger/emacsmacport-exp/emacs-mac-exp@31 --HEAD --with-arc --with-mac-metal --with-optimization-flags --with-xwidgets 1 0%
#9,416 harmonybrew/core/urlview 1 0%
#9,417 osgeo/osgeo4mac/gdal@3.5.3 1 0%
#9,418 jhardenberg/ecmwf/fdb 1 0%
#9,419 clipcat 1 0%
#9,420 petere/postgresql/postgresql@8.4 1 0%
#9,421 getparable/tap/aiu 1 0%
#9,422 philpennock/protocols/sieve-connect --without-bundled-publicsuffix 1 0%
#9,423 rijo-george/tap/waiting-room 1 0%
#9,424 shyiko/kubesec/kubesec --with-short-name 1 0%
#9,425 ipopt 1 0%
#9,426 botfile --HEAD 1 0%
#9,427 glib --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,428 normen/tap/obs-mcu 1 0%
#9,429 neonichu/formulae/trolldrop 1 0%
#9,430 chungchihhan/tap/tracce 1 0%
#9,431 brewsci/bio/mothur 1 0%
#9,432 python@3.15 --with-generic 1 0%
#9,433 ccsepbvr/pbvr/qt@6.11.0 1 0%
#9,434 rfidresearchgroup/proxmark3/proxmark3 --with-small 1 0%
#9,435 ghashtag/tap/vibee --HEAD 1 0%
#9,436 rfidresearchgroup/proxmark3/proxmark3 --with-generic --with-small --without-iso14443b --without-iso15693 1 0%
#9,437 mr-tao/tclreadline/tclreadline 1 0%
#9,438 virtualenvwrapper 1 0%
#9,439 tuist/tuist/tuist@3.20.0 1 0%
#9,440 robotfindskitten --HEAD 1 0%
#9,441 nietthijmen/tap/nietthijmen-cs 1 0%
#9,442 grantcarthew/tap/webctl 1 0%
#9,443 depsilon/tap/shardloom 1 0%
#9,444 libpano 1 0%
#9,445 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,446 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-mac-metal --with-modern-icon --with-native-comp --with-native-compilation --with-natural-title-bar --with-starter 1 0%
#9,447 adr-viewer 1 0%
#9,448 dima424658/tap/tarantool@1.5 1 0%
#9,449 magicaldrizzle/personal/zswapmon 1 0%
#9,450 libdmtx 1 0%
#9,451 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-dbus --with-debug --with-mailutils --with-xwidgets 1 0%
#9,452 procs 1 0%
#9,453 nikhilshinday/tools/gw 1 0%
#9,454 slackdump 1 0%
#9,455 gmailctl 1 0%
#9,456 scross01/tools/searxngr 1 0%
#9,457 miles128/tap/prd-first 1 0%
#9,458 aderuelle/tap/img4tool 1 0%
#9,459 zegervdv/zathura/zathura-djvu 1 0%
#9,460 lazyjj --HEAD 1 0%
#9,461 mutt --HEAD 1 0%
#9,462 libbcg729 1 0%
#9,463 laudiacay/tap/fwts 1 0%
#9,464 sharpedgemarshall/tap/pulumi-tui 1 0%
#9,465 gfxutil 1 0%
#9,466 axu2/kindletool/libarchive-git --HEAD 1 0%
#9,467 agriyakhetarpal/tap/mirinae 1 0%
#9,468 dnovitski/tap/surfshield 1 0%
#9,469 quirkdom/tap/catpult 1 0%
#9,470 libgfshare 1 0%
#9,471 d12frosted/emacs-plus/emacs-plus@29 --with-debug --with-imagemagick --with-modern-yellow-icon --with-no-frame-refocus --with-xwidgets 1 0%
#9,472 maxim-belkin/xorg/xfd 1 0%
#9,473 z80oolong/vte/ptyxis 1 0%
#9,474 cherrytree 1 0%
#9,475 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-imagemagick --with-mailutils 1 0%
#9,476 caian-org/formulas/steghide 1 0%
#9,477 atalayhuryasar/tap/envmove 1 0%
#9,478 quackduck/tap/chanch 1 0%
#9,479 nithilgadde/tap/armada 1 0%
#9,480 pasithea0/tap/siri-cli 1 0%
#9,481 langtutheky/langtutheky/shaka-packager@3.5.0 1 0%
#9,482 gromgit/fuse/ntfs-3g-fuset 1 0%
#9,483 typdiff 1 0%
#9,484 attipaci/pub/supernovas 1 0%
#9,485 libtatsu --HEAD 1 0%
#9,486 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libflite --with-libxml2 --with-openal-soft --with-openapv --with-webp --with-xvid --with-zimg 1 0%
#9,487 paparazzi/paparazzi/ivy-c 1 0%
#9,488 appthreat-vulnerability-db 1 0%
#9,489 waxdred/tap/skylandbar 1 0%
#9,490 transifex-cli 1 0%
#9,491 z80oolong/eaw/mutt-current --HEAD 1 0%
#9,492 xan 1 0%
#9,493 libxspf 1 0%
#9,494 rgcr/formulae/iproute-mac 1 0%
#9,495 infinity811/tap/agent-working 1 0%
#9,496 pointrlabs/vendor/maplibre-map-renderer 1 0%
#9,497 mahopan/tap/mn 1 0%
#9,498 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-ggml --with-libbluray --with-libplacebo --with-libsoxr --with-libvmaf --with-libxml2 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rubberband --with-srt --with-tensorflow --with-two-lame --with-webp --with-whisper-cpp --with-zimg 1 0%
#9,499 osrm-backend --HEAD 1 0%
#9,500 angular-cli 1 0%
#9,501 picoruby --HEAD 1 0%
#9,502 jimon-s/awsmfa/awsmfa 1 0%
#9,503 libcec 1 0%
#9,504 rulesify 1 0%
#9,505 owasp-noir/noir/noir 1 0%
#9,506 clnkr-ai/tap/clnkr 1 0%
#9,507 nexusgen4561/tap/claude-usage-bar 1 0%
#9,508 augustgerro/gh-copilot/gh-copilot 1 0%
#9,509 o6uoq/tap/slidev 1 0%
#9,510 md5deep 1 0%
#9,511 hamimlohani/tap/sweep 1 0%
#9,512 doka-software/tap/translatus 1 0%
#9,513 mracos/tap/x86_64-efi-grub 1 0%
#9,514 hshankar/tap/mdview 1 0%
#9,515 maximus242/tap/grokcode 1 0%
#9,516 dariocurr/tap/shaic 1 0%
#9,517 simonzxm/tap/texpresso --HEAD 1 0%
#9,518 frinsen/tap/whereamip 1 0%
#9,519 ignacio-klyver/tap/bloc 1 0%
#9,520 model-context/yertle/yertle 1 0%
#9,521 avsm/ocaml/oi 1 0%
#9,522 sajal2692/tap/ga-agent-cli 1 0%
#9,523 sajal2692/tap/ynab-cli 1 0%
#9,524 d12frosted/emacs-plus/emacs-plus@29 --with-modern-icon --with-native-comp --with-xwidgets 1 0%
#9,525 gem-release 1 0%
#9,526 harmonybrew/core/libusb 1 0%
#9,527 jcable/dream/hamlib@3.3 1 0%
#9,528 ktk/qlever/qlever --HEAD 1 0%
#9,529 helib 1 0%
#9,530 gtk-vnc 1 0%
#9,531 mulle-kybernetik/software/mulle-sde 1 0%
#9,532 sohryuu101/claude-usage-bar/claude-usage-bar 1 0%
#9,533 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-mac-metal --with-native-comp --with-natural-title-bar --with-starter --with-unlimited-select --with-xwidgets 1 0%
#9,534 qtcanvaspainter --HEAD 1 0%
#9,535 finnove/notes-md/notes-md 1 0%
#9,536 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,537 kemalasliyuksek/coreit-vpn/coreit-vpn 1 0%
#9,538 davidkang/tarkon/tarkon 1 0%
#9,539 danlennon/atomic-commit/atomic-commit 1 0%
#9,540 nextflow 1 0%
#9,541 pzmuv1517/pzmuv1517/pusher 1 0%
#9,542 clangen/musikcube/musikcube 1 0%
#9,543 zonble/zago/zago 1 0%
#9,544 alankyshum/tap/kilo-claude-proxy 1 0%
#9,545 leoafarias/fvm/fvm@3.0.0 1 0%
#9,546 lz-lunzi/buket/orca 1 0%
#9,547 mrklein/foam/parmgridgen 1 0%
#9,548 octave-app/octave-app/octave@9.4.0 1 0%
#9,549 masscan --HEAD 1 0%
#9,550 hiroshi-kamikawa/tap/simple-screenshot 1 0%
#9,551 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,552 honker 1 0%
#9,553 bwfmetaedit 1 0%
#9,554 zcsabbagh/tap/flashcards-mcp 1 0%
#9,555 cyclonedx-yarn 1 0%
#9,556 tremc 1 0%
#9,557 daviderestivo/emacs-head/emacs-head@29 --with-cocoa --with-modern-icon-sexy-v1 --with-native-comp 1 0%
#9,558 youtube-dl --HEAD 1 0%
#9,559 python@2 1 0%
#9,560 harmonybrew/core/mosquitto 1 0%
#9,561 nejohnson2/sdr/rtlsdr --HEAD 1 0%
#9,562 ayhid/tidyfiles/tidyfiles 1 0%
#9,563 glibc@2.39 1 0%
#9,564 flare576/scripts/dvol 1 0%
#9,565 dexhunter/vibe/vibe-clock 1 0%
#9,566 Exo 1 0%
#9,567 shivammathur/extensions/maxminddb@7.2 1 0%
#9,568 shivammathur/extensions/oauth@7.0 1 0%
#9,569 shivammathur/extensions/seaslog@8.5 1 0%
#9,570 shivammathur/extensions/maxminddb@8.5 1 0%
#9,571 yesawoo/tap/kleo-receipts 1 0%
#9,572 ongjin/ttak/ttak 1 0%
#9,573 arustydev/tap/smart-tree 1 0%
#9,574 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,575 arustydev/tap/devrag 1 0%
#9,576 sulimanbenhalim/ga-cli/ga-cli 1 0%
#9,577 scdozier/stepsheet/stepsheet 1 0%
#9,578 vibe-kanban 1 0%
#9,579 paulilaaso/tap/hys 1 0%
#9,580 o6uoq/tap/tmux-ide 1 0%
#9,581 maif/wasmo/wasmo 1 0%
#9,582 maxim-belkin/xorg/bitmap 1 0%
#9,583 veryfasttree 1 0%
#9,584 anonymort/clippybox/clippybox 1 0%
#9,585 onlykey-agent 1 0%
#9,586 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-fdk-aac --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,587 rajulbabel/claude/permit 1 0%
#9,588 tennyson-mccalla/tap/genmedia 1 0%
#9,589 cf2tf 1 0%
#9,590 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-ggml --with-libbluray --with-libdvdread --with-libplacebo --with-librsvg --with-libtensorflow --with-openh264 --with-openjpeg --with-rav1e --with-tensorflow --with-tesseract --with-webp --with-whisper-cpp --with-zimg 1 0%
#9,591 freecad/freecad/freecad@1.0.2_py313_qt6 --HEAD 1 0%
#9,592 metabase --HEAD 1 0%
#9,593 omega 1 0%
#9,594 siafoundation/sia/renterd 1 0%
#9,595 jdx/tap/usage 1 0%
#9,596 p11-kit --with-decklink 1 0%
#9,597 elastic/geneve/geneve 1 0%
#9,598 avahi 1 0%
#9,599 broberson/bfgminer/bfgminer 1 0%
#9,600 homebrew-ffmpeg/ffmpeg/ffmpeg --with-jpeg-xl 1 0%
#9,601 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libmodplug --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,602 ruby@3.2 1 0%
#9,603 ensembl/ensembl/vienna-rna 1 0%
#9,604 tehzz/n64-dev/mips64-elf-binutils --with-native-comp 1 0%
#9,605 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-ctags --with-dbus --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-natural-title-bar --with-starter 1 0%
#9,606 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-imagemagick --with-librsvg --with-native-compilation --with-no-title-bars --with-starter --with-xwidgets 1 0%
#9,607 skarchybar2.21.0 1 0%
#9,608 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-vscode-icon --with-xwidgets 1 0%
#9,609 d12frosted/emacs-plus/emacs-plus@30 --with-c9rgreen-sonoma-icon --with-imagemagick --with-no-frame-refocus --with-xwidgets 1 0%
#9,610 sirnerdbear/openssh-gssapi/openssh-patched --with-gssapi-support --with-keychain-support 1 0%
#9,611 repomix 1 0%
#9,612 xleak 1 0%
#9,613 jsr-probitas/tap/probitas 1 0%
#9,614 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-xwidgets 1 0%
#9,615 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-sexy-v2-icon --with-xwidgets 1 0%
#9,616 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-unlimited-select 1 0%
#9,617 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-unlimited-select --without-modules 1 0%
#9,618 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-dbus --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-native-comp --with-natural-title-bar 1 0%
#9,619 gdal --with-ctags --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-natural-title-bar --with-starter --with-unlimited-select 1 0%
#9,620 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-natural-title-bar --with-starter --with-unlimited-select 1 0%
#9,621 tfel 1 0%
#9,622 shakacode/brew/curl-impersonate --with-xwidgets 1 0%
#9,623 wish/wish/dobi 1 0%
#9,624 ak9024/rustywatch/rustywatch 1 0%
#9,625 brian-slate/juice-it/juice-it 1 0%
#9,626 tecolicom/tap/app-nup 1 0%
#9,627 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-svt-av1 --with-tesseract 1 0%
#9,628 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-libvmaf --with-svt-av1 1 0%
#9,629 gromgit/brewtils/bold-brew 1 0%
#9,630 html2markdown 1 0%
#9,631 mbtz/agent-skills/askill 1 0%
#9,632 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libplacebo --with-svt-av1 --with-zimg 1 0%
#9,633 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-big-sur-icon --with-librsvg --with-mac-metal --with-native-comp --with-starter 1 0%
#9,634 vineflower 1 0%
#9,635 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-librsvg --with-native-compilation --with-starter 1 0%
#9,636 dlr-ts/sumo/sumo --with-swig 1 0%
#9,637 d12frosted/emacs-plus/emacs-plus@29 --without-cocoa 1 0%
#9,638 lgarron/lgarron/rmbranch --HEAD 1 0%
#9,639 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-starter --with-xwidgets 1 0%
#9,640 michellepellon/tap/feedback 1 0%
#9,641 kanglin/rabbitcommon/rabbitcommon 1 0%
#9,642 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-big-sur-icon --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-natural-title-bar 1 0%
#9,643 dm3ch/tap/git-profile-manager 1 0%
#9,644 jcudit/webkitgtk/webkitgtk --HEAD 1 0%
#9,645 bracken 1 0%
#9,646 tizee/personal/tmux --HEAD 1 0%
#9,647 gau 1 0%
#9,648 stigmer/tap/stigmer 1 0%
#9,649 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-decklink --with-srt 1 0%
#9,650 vapoursynth-mvtools --HEAD 1 0%
#9,651 letta-code 1 0%
#9,652 oliverjessner/tap/clipspin 1 0%
#9,653 vdt 1 0%
#9,654 homebrew-ffmpeg/ffmpeg/ffmpeg --with-openjpeg --with-zimg 1 0%
#9,655 cxwx/cxbrew/pal 1 0%
#9,656 cxwx/cxbrew/argh 1 0%
#9,657 circleci --HEAD 1 0%
#9,658 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,659 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,660 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,661 sunknudsen/tap/wakeful 1 0%
#9,662 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint 1 0%
#9,663 jackieju/tools/ai-agent-smart-voice-input 1 0%
#9,664 flexolumens/tap/flx 1 0%
#9,665 mu-semtech/scripts/docker-ssh-agent-forward 1 0%
#9,666 jeancsil/tap/raw2jpeg 1 0%
#9,667 corklang/tap/corklang 1 0%
#9,668 gretel/sdr/libad9361-iio 1 0%
#9,669 vincentkoc/tap/agentrinse 1 0%
#9,670 bandit 1 0%
#9,671 sniffles 1 0%
#9,672 undivisible/tap/wax 1 0%
#9,673 abhinavsns/openfpm/libhilbert 1 0%
#9,674 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-pgtk --without-cocoa 1 0%
#9,675 ramalama 1 0%
#9,676 logstalgia 1 0%
#9,677 raulgg/tap/airpods-control 1 0%
#9,678 legambiart/wtmcp/wtmcp --HEAD 1 0%
#9,679 life2you/tap/ashlogin 1 0%
#9,680 life2you/tap/gmux 1 0%
#9,681 life2you/tap/gwtm 1 0%
#9,682 soulhakr/tap/phi 1 0%
#9,683 virtiofsd 1 0%
#9,684 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-dvd --with-fdk-aac --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,685 vinurs/emacs-plus/emacs-plus@32 --with-dbus --with-debug --with-mailutils --with-xwidgets 1 0%
#9,686 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-modern-icon-emacs-icon4 --with-native-comp 1 0%
#9,687 armaniacs/sasurahime/sasurahime 1 0%
#9,688 railwaycat/emacsmacport/emacs-mac@28 1 0%
#9,689 joelee/oss/gmail-tool 1 0%
#9,690 tbvdm/tap/sigbak --HEAD 1 0%
#9,691 fltk --HEAD 1 0%
#9,692 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libaribb24 --with-two-lame --with-webp --with-zimg 1 0%
#9,693 mspdebug 1 0%
#9,694 abinit/tap/abinit --without-test 1 0%
#9,695 linuxkit/linuxkit/linuxkit --HEAD 1 0%
#9,696 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-ggml --with-jpeg-xl --with-libbluray --with-libdvdnav --with-libdvdread --with-libopenmpt --with-libplacebo --with-libzvbi --with-srt --with-whisper-cpp --with-zimg 1 0%
#9,697 fortrangoingonforty/tap/fortsh 1 0%
#9,698 danielsmedegaardbuus/par2tbb/par2tbb 1 0%
#9,699 fortitude 1 0%
#9,700 lucuma13/dit/mhlver 1 0%
#9,701 lemon 1 0%
#9,702 shivammathur/extensions/ds@8.1 1 0%
#9,703 aquarco/tap/aquarco 1 0%
#9,704 bl4cc4t/vsplugins/vsp-ttempsmooth --HEAD 1 0%
#9,705 confighub/tap/cub-scout 1 0%
#9,706 redocly-cli 1 0%
#9,707 openfga 1 0%
#9,708 brianm/tools/ddbc 1 0%
#9,709 inspect 1 0%
#9,710 zeeshanjan/ytclip/ytclip 1 0%
#9,711 sergeykolosov/tap/globalprotect-openconnect-slim 1 0%
#9,712 denvig/tap/denvig-alpha 1 0%
#9,713 netcat 1 0%
#9,714 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,715 spaghettifunk/tap/flamingo 1 0%
#9,716 proto 1 0%
#9,717 miguelriotinto/clauderelay/clauderelay --HEAD 1 0%
#9,718 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-glib --with-imagemagick --with-mac-metal --with-modern-icon --with-native-compilation --with-natural-title-bar --with-starter --with-unlimited-select 1 0%
#9,719 jmaleonard/tap/tripwire --HEAD 1 0%
#9,720 d12frosted/emacs-plus/emacs-plus@30 --HEAD --with-imagemagick 1 0%
#9,721 pixi-pack 1 0%
#9,722 cxwx/cxbrew/deepseek-tui 1 0%
#9,723 dash-shell 1 0%
#9,724 unshield 1 0%
#9,725 pubino/envault/envault 1 0%
#9,726 thegoatsmith/twilight/twilight 1 0%
#9,727 svt/avtools/libsrf-proxy-filter 1 0%
#9,728 kosli-cli 1 0%
#9,729 qtquick3d --HEAD 1 0%
#9,730 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libaribb24 --with-libbluray --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-opencore-amr --with-openjpeg --with-rav1e --with-rubberband --with-speex --with-srt --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,731 mohamedelashri/free-mac/free-mac 1 0%
#9,732 piopulse 1 0%
#9,733 scivisum/tap/openssl@1.1 1 0%
#9,734 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-generic --without-qt@5 1 0%
#9,735 tubeup 1 0%
#9,736 protobuf@3 1 0%
#9,737 glennakamura/repo/pcscd 1 0%
#9,738 eso/pipelines/esopipe-xshoo-recipes 1 0%
#9,739 rabbitmq 1 0%
#9,740 httpie --HEAD 1 0%
#9,741 cahute --HEAD 1 0%
#9,742 simple-mtpfs 1 0%
#9,743 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-ggml --with-jpeg-xl --with-librsvg --with-libsoxr --with-libvidstab --with-libzvbi --with-rav1e --with-rubberband --with-tensorflow --with-tesseract --with-webp --with-whisper-cpp --with-xvid 1 0%
#9,744 codegraph 1 0%
#9,745 alhadis/troff/deroff 1 0%
#9,746 cxwx/cxbrew/vale-ls 1 0%
#9,747 asciidoc --with-gssapi-support 1 0%
#9,748 mohamed-elkholy95/pythinker/pythinker-ai 1 0%
#9,749 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,750 hlrs-vis/tap/extrae 1 0%
#9,751 harmonybrew/core/cryptography 1 0%
#9,752 sdl2_gfx 1 0%
#9,753 alejandra 1 0%
#9,754 ammarabouzor/tui-journal/tui-journal 1 0%
#9,755 conan-mcp 1 0%
#9,756 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,757 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-ggml --with-libplacebo --with-tensorflow --with-webp --with-whisper-cpp 1 0%
#9,758 cbonsai 1 0%
#9,759 rvvm --HEAD 1 0%
#9,760 ouch --HEAD 1 0%
#9,761 christmic/tap/token9 --HEAD 1 0%
#9,762 socktainer/tap/socktainer --HEAD 1 0%
#9,763 yarden-zamir/tap/kitshn 1 0%
#9,764 swiftwinds/idevice/idevicerestore 1 0%
#9,765 asitop 1 0%
#9,766 rfidresearchgroup/proxmark3/proxmark3 --with-generic --with-small --without-qt@5 1 0%
#9,767 go2starr/tap/ghosh 1 0%
#9,768 akunzai/tap/gistui 1 0%
#9,769 fm2003/tap/cbqn 1 0%
#9,770 moc 1 0%
#9,771 shinyaoguri/tap/metaphor 1 0%
#9,772 riscv64-elf-binutils 1 0%
#9,773 audit 1 0%
#9,774 harmonybrew/core/languagetool 1 0%
#9,775 badluma/tap/comprobot 1 0%
#9,776 0xf07ce/tap/vtplayer 1 0%
#9,777 k8s-old-cli 1 0%
#9,778 harmonybrew/core/openldap 1 0%
#9,779 harmonybrew/core/lmdb 1 0%
#9,780 c0rmac/involute/involute-mlx 1 0%
#9,781 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-libvmaf --with-openjpeg --with-srt 1 0%
#9,782 david0/audio/calf --with-cairo 1 0%
#9,783 fades 1 0%
#9,784 tgtakaoka/mspdebug-mspds/msp-ds 1 0%
#9,785 qt3d --HEAD 1 0%
#9,786 qtsvg --HEAD 1 0%
#9,787 tmux-fingers 1 0%
#9,788 h3arn/mytap/aria2 1 0%
#9,789 topydo 1 0%
#9,790 jupyter-r 1 0%
#9,791 torognes/bioinf/compairr 1 0%
#9,792 yarn 1 0%
#9,793 elmercsc/elmerfem/elmer --without-hypre 1 0%
#9,794 azure-cli --HEAD 1 0%
#9,795 danielkulenkamp/ichnaea/ichnaea 1 0%
#9,796 mattholihan/tap/markitdown-gui 1 0%
#9,797 matmartinez/tools/blocksay 1 0%
#9,798 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-libbluray --with-libbs2b --with-libgsm --with-libmodplug --with-libopenmpt --with-librsvg --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openjpeg --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,799 navinagrawal/tap/mcp-broker 1 0%
#9,800 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-native-comp --with-native-full-aot --with-xwidgets 1 0%
#9,801 jin-ttao/tap/resumer 1 0%
#9,802 marcqualie/nginx/nginx-full --with-addition --with-anti-ddos-module --with-gzip-static --with-headers-more-module --with-tcp-proxy-module 1 0%
#9,803 iopsystems/iop/systemslab 1 0%
#9,804 terminator 1 0%
#9,805 dirstral/tap/dir2mcp-full 1 0%
#9,806 dxrcy/elk/elk --HEAD 1 0%
#9,807 spice-server --HEAD 1 0%
#9,808 chronicle-app/etl/chronicle-etl 1 0%
#9,809 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jpeg-xl --with-openal-soft --with-openh264 --with-openjpeg --with-rav1e --with-srt --with-webp 1 0%
#9,810 cxwx/cxbrew/pygame 1 0%
#9,811 mailutils 1 0%
#9,812 arrayfire 1 0%
#9,813 igraph 1 0%
#9,814 andyyyy64/whichllm/whichllm --with-llm 1 0%
#9,815 ghc@8.10 1 0%
#9,816 grimley517/tap/notetaker --HEAD 1 0%
#9,817 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-modern-icon-emacs-icon4 1 0%
#9,818 svt/avtools/libsvg-proxy-filter --HEAD 1 0%
#9,819 lan-shengchieh/tap/keyclean 1 0%
#9,820 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libbs2b --with-libgsm --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,821 harmonybrew/core/lazygit 1 0%
#9,822 code2prompt 1 0%
#9,823 gillisd/tap/duckdb --HEAD 1 0%
#9,824 thinkiny/emacs-plus/emacs-plus@32 --with-frame-transparency --with-savchenkovaleriy-big-sur-icon --with-xwidgets 1 0%
#9,825 swift-sh 1 0%
#9,826 kics 1 0%
#9,827 foxglove-cli 1 0%
#9,828 quilldev/tap/nanotes 1 0%
#9,829 ggml --HEAD 1 0%
#9,830 emreerinc/tap/envforge 1 0%
#9,831 kubectl-radar 1 0%
#9,832 dfu-util 1 0%
#9,833 bigloo 1 0%
#9,834 wget2 1 0%
#9,835 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,836 yannjor/krabby/krabby 1 0%
#9,837 postgresql@9.6 1 0%
#9,838 ghostty 1 0%
#9,839 john-athan/tap/sucher 1 0%
#9,840 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-native-compilation --with-natural-title-bar --with-xwidgets 1 0%
#9,841 geckodriver 1 0%
#9,842 manticoresoftware/tap-dev/manticore-language-packs 1 0%
#9,843 emilevr/space/space 1 0%
#9,844 jbig2dec 1 0%
#9,845 pothosware/pothos/soapyiris --HEAD 1 0%
#9,846 shyamalschandra/idea2circuit/flux-circuits 1 0%
#9,847 harness-cli 1 0%
#9,848 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-modern-paper-icon 1 0%
#9,849 indilib/indi/indi-eqmod 1 0%
#9,850 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libbluray --with-libflite --with-libplacebo --with-librsvg --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-svt-av1 --with-tesseract --with-webp --with-whisper-cpp --with-xvid 1 0%
#9,851 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libbluray --with-libflite --with-libplacebo --with-librsvg --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-svt-av1 --with-tesseract --with-webp --with-whisper-cpp --with-xvid 1 0%
#9,852 greghuels/tap/git-fury 1 0%
#9,853 hhvm/hhvm/hhvm-4.163 1 0%
#9,854 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-mac-metal --with-native-compilation 1 0%
#9,855 lescanauxdiscrets/tap/ffmpeg --with-chromaprint --with-fdk-aac --with-librsvg --with-libsoxr --with-libvidstab --with-libvmaf --with-libzvbi --with-rtmpdump --with-srt --with-tesseract --with-webp 1 0%
#9,856 facebook/fb/buck --HEAD 1 0%
#9,857 gitea-runner 1 0%
#9,858 digitalspacestdio/php/php84-imagick 1 0%
#9,859 igram7/xchtml/xchtml 1 0%
#9,860 homebrew-ffmpeg/ffmpeg/ffmpeg --with-cairo --with-dvd --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,861 d12frosted/emacs-plus/emacs-plus@31 --HEAD --with-xwidgets 1 0%
#9,862 akinokaede/kuchikamizake/pinentry-mac-swift 1 0%
#9,863 shivammathur/extensions/pinba@8.6 1 0%
#9,864 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-debug --with-imagemagick --with-xwidgets 1 0%
#9,865 azatisakov/finderctl/finderctl 1 0%
#9,866 pothosware/pothos/pothosplotters 1 0%
#9,867 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,868 samsinghh/tap/pomo 1 0%
#9,869 pastydev/cmdict/cmdict 1 0%
#9,870 zxygch/ww3tool/ww3tool 1 0%
#9,871 sapn95/tap/pfadi 1 0%
#9,872 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,873 libngspice --HEAD 1 0%
#9,874 homebrew-zathura/zathura/synctex 1 0%
#9,875 simple-amqp-client --HEAD 1 0%
#9,876 vladistan/gizmos/invoice-tool 1 0%
#9,877 freecad/freecad/swig@4.2.1 1 0%
#9,878 cherepavel/python/python@3.7 1 0%
#9,879 mcs07/cheminformatics/indigo 1 0%
#9,880 soutaro/nullarihyon/nullarihyon 1 0%
#9,881 multimarkdown 1 0%
#9,882 dicebear 1 0%
#9,883 dgarnier/plasma/petsc-m3dc1 1 0%
#9,884 danieljprice/all/swarp 1 0%
#9,885 hidapitester 1 0%
#9,886 cesanta/mos/mos-latest 1 0%
#9,887 simgrid 1 0%
#9,888 uvw 1 0%
#9,889 alvarr55/clawdmeter/clawdmeter 1 0%
#9,890 mrtrix3/mrtrix3/mrtrix3 1 0%
#9,891 harmonybrew/core/fping 1 0%
#9,892 pscale 1 0%
#9,893 markassad/a2fuse/a2fuse 1 0%
#9,894 frostyard/tap/hermes-agent-desktop 1 0%
#9,895 resterm 1 0%
#9,896 leo1394/conven/conven 1 0%
#9,897 microsoft/mssql-release/msodbcsql18@18.5.1.1 1 0%
#9,898 universal-ctags 1 0%
#9,899 shivammathur/extensions/memcache@5.6 1 0%
#9,900 newrelic/tap/newrelic-infra-agent 1 0%
#9,901 duckyfuz/tap/colm 1 0%
#9,902 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-ggml --with-libflite --with-librsvg --with-libvmaf --with-rtmpdump --with-webp --with-whisper-cpp 1 0%
#9,903 vapor --HEAD 1 0%
#9,904 paulrosania/command-home/picoleaf 1 0%
#9,905 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-openh264 --with-openjpeg --with-webp 1 0%
#9,906 suphammer/misc/lib3mf 1 0%
#9,907 awsdac --HEAD 1 0%
#9,908 veelenga/tap/ameba 1 0%
#9,909 your-tools/repo/ruplacer 1 0%
#9,910 kubectl-ai --HEAD 1 0%
#9,911 yyjson 1 0%
#9,912 crc32c 1 0%
#9,913 jeffkit/tap/im-agentproc 1 0%
#9,914 pmeinhardt/tools/ql --HEAD 1 0%
#9,915 adelie-ai/adelie/adele-tui --HEAD 1 0%
#9,916 libbluray --HEAD 1 0%
#9,917 danhorst/tap/gemkeeper 1 0%
#9,918 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-librist --with-srt 1 0%
#9,919 weethet/tap/cubiomes-viewer 1 0%
#9,920 dgarnier/plasma/fusion-io 1 0%
#9,921 dmitryrollins/llmind/llmind-cli 1 0%
#9,922 leftrk/tap/openclaude 1 0%
#9,923 tranhuucanh/fastqr/fastqr 1 0%
#9,924 freecad/freecad/coin3d@4.0.8_py313_qt6 1 0%
#9,925 designbynumbers/cantarellalab/ridgerunner 1 0%
#9,926 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,927 harmonybrew/core/xh 1 0%
#9,928 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-natural-title-bar --with-starter 1 0%
#9,929 brewsci/science/fcgene 1 0%
#9,930 brewsci/science/ensembl-tools 1 0%
#9,931 brewsci/science/edena 1 0%
#9,932 brewsci/science/corset 1 0%
#9,933 brewsci/science/concorde 1 0%
#9,934 tycho/tap/clang-format --HEAD 1 0%
#9,935 neved4/tap/twc 1 0%
#9,936 pasithea0/siri-cli/siri-cli 1 0%
#9,937 oliviahelmuth/ascii-video-chat/ascii-video-chat 1 0%
#9,938 dvorak7min 1 0%
#9,939 codegod100/tap/sleek 1 0%
#9,940 gobject-introspection --with-xwidgets 1 0%
#9,941 bulk_extractor 1 0%
#9,942 jdunn596/tap/n64 --HEAD 1 0%
#9,943 nastro 1 0%
#9,944 1f47e/tap/booxdrop 1 0%
#9,945 chronoscrat/tap-public/mb-cli 1 0%
#9,946 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libbluray --with-librsvg --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openjpeg --with-rubberband --with-speex --with-srt --with-webp --with-xvid --with-zimg 1 0%
#9,947 embeddable-hq/embeddable/embed 1 0%
#9,948 pentwist23/ji-image-converter/ji-image-converter 1 0%
#9,949 homebrew-ffmpeg/ffmpeg/ffmpeg --with-onnxruntime 1 0%
#9,950 kabel/pecl/php-tideways-xhprof 1 0%
#9,951 vsd 1 0%
#9,952 openrtm/openrtm2/openrtm2-python-py314 1 0%
#9,953 cforge 1 0%
#9,954 harmonybrew/core/libnetfilter_conntrack 1 0%
#9,955 rig 1 0%
#9,956 ljdongz/tap/mocka 1 0%
#9,957 cssr-tools/opm/trilinos 1 0%
#9,958 drorkremer/m365-mcp/m365-mcp 1 0%
#9,959 qdmr 1 0%
#9,960 maplibre-native 1 0%
#9,961 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,962 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,963 abinit/tap/abinit --without-scalapack 1 0%
#9,964 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#9,965 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-natural-title-bar 1 0%
#9,966 traildb/judy/judy 1 0%
#9,967 hyfetch 1 0%
#9,968 observal-cli 1 0%
#9,969 rexx-org/rexx-org/oorexx 1 0%
#9,970 ghr 1 0%
#9,971 denji/nginx/nginx-full --with-anti-ddos-module --with-brotli-module --with-dosdetector-module --with-fancyindex-module --with-flv --with-http2 --with-mp4 --with-naxsi-module --with-realip --with-rtmp-module --with-secure-link --with-status --with-subs-filter-module --with-vod-module --with-vts-module 1 0%
#9,972 harmonybrew/core/git-annex 1 0%
#9,973 kabel/php-ext/php@8.3-enchant 1 0%
#9,974 xberg-io/tap/xberg --HEAD 1 0%
#9,975 brewsci/bio/gatk 1 0%
#9,976 brewsci/bio/salmon@1 1 0%
#9,977 hasansezertasan/tap/keycast 1 0%
#9,978 headroom 1 0%
#9,979 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-tree-sitter 1 0%
#9,980 kurogin23mech-source/beacon/beacon 1 0%
#9,981 yek 1 0%
#9,982 gerust 1 0%
#9,983 chyroc/tap/otp-cli 1 0%
#9,984 mutagen-io/mutagen/mutagen-beta 1 0%
#9,985 mergifyio/tap/mergify-cli 1 0%
#9,986 qthttpserver --HEAD 1 0%
#9,987 bl4cc4t/vsplugins/vsp-addgrain 1 0%
#9,988 raylib --HEAD 1 0%
#9,989 genericje/tools/enter-presser 1 0%
#9,990 sp1ritcs/tap/clatexmath 1 0%
#9,991 tamentis/core/prwd 1 0%
#9,992 the-hcma/tap/rusty-jack 1 0%
#9,993 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#9,994 eskelinenantti/cli/tmuxide 1 0%
#9,995 gup 1 0%
#9,996 fairrootgroup/fairsoft/fairsoft@22.4 1 0%
#9,997 mtg/essentia/essentia --HEAD --with-gaia 1 0%
#9,998 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --without-modules 1 0%
#9,999 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-no-title-bars --with-starter --with-unlimited-select --with-xwidgets 1 0%
#10,000 pygobject3 --with-dvd --with-libbluray 1 0%
#10,001 systemd --HEAD 1 0%
#10,002 taclane/sdr/gr-osmosdr 1 0%
#10,003 pkryger/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-arc --with-mac-metal --with-no-title-bars --with-optimization-flags --with-spacemacs-icon --with-starter --with-unlimited-select 1 0%
#10,004 d12frosted/emacs-plus/emacs-plus@30 --with-cacodemon-icon --with-imagemagick --with-xwidgets 1 0%
#10,005 philpennock/protocols/sieve-connect --HEAD --with-brew-perl 1 0%
#10,006 rnp 1 0%
#10,007 openvino --HEAD 1 0%
#10,008 elmercsc/elmerfem/elmer --with-elmergui --with-testing 1 0%
#10,009 angband 1 0%
#10,010 d12frosted/emacs-plus/emacs-plus@29 --HEAD 1 0%
#10,011 openjph --HEAD 1 0%
#10,012 pbzip2 1 0%
#10,013 redress 1 0%
#10,014 wallix/awless/awless 1 0%
#10,015 wanderingstan/vibe-check/vibe-check 1 0%
#10,016 sidneys/homebrew/binutils 1 0%
#10,017 tigger04/tap/smart-rename 1 0%
#10,018 diamond --HEAD 1 0%
#10,019 lgarron/lgarron/openscad-auto --HEAD 1 0%
#10,020 modern-tooling/tap/work-lab 1 0%
#10,021 rhajizada/tap/signum 1 0%
#10,022 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libbluray 1 0%
#10,023 elmercsc/elmerfem/elmer --with-elmergui --without-hypre --without-mumps 1 0%
#10,024 littlebearapps/token-audit/token-audit 1 0%
#10,025 da-luce/astroterm/astroterm 1 0%
#10,026 serie 1 0%
#10,027 jhladik/formulas/nextpnr-ice40 --HEAD 1 0%
#10,028 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-modern-paper-icon 1 0%
#10,029 nickygerritsen/tap/switchboard 1 0%
#10,030 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-imagemagick --with-mailutils 1 0%
#10,031 alsesa/tap/sense-voice 1 0%
#10,032 aaratha/emacs-plus/emacs-plus@29 --with-dbus --with-imagemagick --with-mailutils --with-native-comp --with-xwidgets 1 0%
#10,033 filosottile/musl-cross/musl-cross --with-mipsel 1 0%
#10,034 wifitui --HEAD 1 0%
#10,035 depot --HEAD 1 0%
#10,036 0f-0b/mkxp/rgss-script-editor 1 0%
#10,037 quanuanc/tap/mihomo 1 0%
#10,038 projectable 1 0%
#10,039 linux-headers@4.4 1 0%
#10,040 ta7mid/personal/vicinae 1 0%
#10,041 bungakecil/tap/sql2sqlite 1 0%
#10,042 h3 1 0%
#10,043 harmonybrew/core/gascity 1 0%
#10,044 harmonybrew/core/pgbackrest 1 0%
#10,045 ayoubhamd/tap/hostely 1 0%
#10,046 vulkan-profiles --HEAD 1 0%
#10,047 freecad/freecad/freecad@1.1.3_py313_qt6 --HEAD 1 0%
#10,048 glimpse 1 0%
#10,049 mio9/tap/notif 1 0%
#10,050 osrf/simulation/gz-plugin2 1 0%
#10,051 brewsci/science/spici 1 0%
#10,052 brewsci/science/snap-aligner 1 0%
#10,053 brewsci/science/sbagen 1 0%
#10,054 brewsci/science/rml-mmc 1 0%
#10,055 brewsci/science/maq 1 0%
#10,056 brewsci/science/lobstr 1 0%
#10,057 brewsci/science/libminc 1 0%
#10,058 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,059 mcp-proxy 1 0%
#10,060 libvirt-glib 1 0%
#10,061 homebrew-ffmpeg/ffmpeg/ffmpeg --with-openh264 --with-rav1e --with-tesseract --with-webp 1 0%
#10,062 sophus 1 0%
#10,063 codecademy-engineering/bootstrap/helmfile@0.144.0 1 0%
#10,064 koekeishiya/formulae/yabai 1 0%
#10,065 py3cairo 1 0%
#10,066 gstreamer --HEAD 1 0%
#10,067 restish 1 0%
#10,068 brewsci/bio/gffcompare 1 0%
#10,069 llvm-hs/llvm/llvm-11 1 0%
#10,070 brlaser --HEAD 1 0%
#10,071 digitaltvguy/ffmpeg-digitaltvguy/ffmpeg 1 0%
#10,072 test-rust-repo 1 0%
#10,073 unpaper --HEAD 1 0%
#10,074 agentgazer/tap/agentgazer 1 0%
#10,075 allenhack638/bucket-manager/bucket-manager 1 0%
#10,076 ruby@3.4 1 0%
#10,077 harmonybrew/core/ffmpeg --HEAD 1 0%
#10,078 mechanicpanic/tap/lampa 1 0%
#10,079 louisescher/tap/hangar 1 0%
#10,080 duckscript 1 0%
#10,081 vcargats/gr-osmosdr/gr-osmosdr 1 0%
#10,082 denji/nginx/nginx-full --with-anti-ddos-module --with-brotli-module --with-dosdetector-module --with-fancyindex-module --with-flv --with-http2 --with-mp4 --with-naxsi-module --with-realip --with-rtmp-module --with-secure-link --with-status --with-subs-filter-module --with-upstream-check-module --with-vod-module --with-vts-module 1 0%
#10,083 tbaudier/core/root@6.28 1 0%
#10,084 search-that-hash --HEAD 1 0%
#10,085 brianm/tools/jp 1 0%
#10,086 aaratha/emacs-plus/emacs-plus@30 --with-native-comp --with-xwidgets 1 0%
#10,087 acidtib/kamal/kamal 1 0%
#10,088 pjproject 1 0%
#10,089 neved4/tap/cut-cdn 1 0%
#10,090 n8n-mcp 1 0%
#10,091 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-libvmaf --with-srt --with-svt-av1 --with-whisper-cpp 1 0%
#10,092 premake --HEAD 1 0%
#10,093 kubeshark 1 0%
#10,094 amperity/chuck-data/chuck-data 1 0%
#10,095 catesandrew/tap/gcc --HEAD 1 0%
#10,096 kfr 1 0%
#10,097 richard-vd/musl-cross/musl-cross --with-i486 1 0%
#10,098 shopify/shopify/libgda@5 1 0%
#10,099 osrf/simulation/gz-plugin3 1 0%
#10,100 gitseti/tap/hmq-tui 1 0%
#10,101 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-modern-doom3-icon 1 0%
#10,102 codeshipai/tap/agentflow 1 0%
#10,103 msgpack 1 0%
#10,104 vladistan/gizmos/repo-sync-kitty 1 0%
#10,105 soapyhackrf 1 0%
#10,106 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-native-comp 1 0%
#10,107 molten-vk --with-debug 1 0%
#10,108 rawdog --HEAD 1 0%
#10,109 qtwayland --HEAD 1 0%
#10,110 guile-gnutls --HEAD 1 0%
#10,111 vacuum --HEAD 1 0%
#10,112 na-trium-144/webcface/vips-lite 1 0%
#10,113 erlang@25 1 0%
#10,114 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jack --with-openssl@3 --with-openvino --with-speex --with-srt --with-webp 1 0%
#10,115 wysenynja/bitcoin/vanitygen 1 0%
#10,116 lizardbyte/homebrew/sunshine --with-docs --with-static-boost 1 0%
#10,117 virtualzone/tap/onedrive-uploader 1 0%
#10,118 alexsjones/kflow/kflow 1 0%
#10,119 d12frosted/emacs-plus/emacs-plus@29 --with-c9rgreen-sonoma-icon 1 0%
#10,120 d12frosted/emacs-plus/emacs-plus@31 --with-modern-black-dragon-icon 1 0%
#10,121 dorkitude/linctl/linctl 1 0%
#10,122 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-imagemagick --with-mailutils --with-nobu417-big-sur-icon --with-xwidgets 1 0%
#10,123 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-savchenkovaleriy-big-sur-icon 1 0%
#10,124 aegiosot/ybar/ybar --HEAD 1 0%
#10,125 dimpase/tap/cliquer 1 0%
#10,126 mfem 1 0%
#10,127 shawnz/printing/cups-filters 1 0%
#10,128 scanaislop/tap/aislop 1 0%
#10,129 hugo-dz/tap/spritefusion-pixel-snapper 1 0%
#10,130 d1v 1 0%
#10,131 jlp04/homebrew/tilp 1 0%
#10,132 nuanu-ai/tap/apn 1 0%
#10,133 vjeantet/tap/alerter 1 0%
#10,134 baxtor/qemu-virgl/virglrenderer 1 0%
#10,135 dashorama/tap/rewound 1 0%
#10,136 gssdp 1 0%
#10,137 jaimealonsoga/tap/hop 1 0%
#10,138 sponge 1 0%
#10,139 shivammathur/extensions/lua@8.6 1 0%
#10,140 homebrew-ffmpeg/ffmpeg/ffmpeg --with-ggml --with-whisper-cpp 1 0%
#10,141 wangnan0916/ssh-forward/ssh-forward 1 0%
#10,142 wasmedge --HEAD 1 0%
#10,143 langchain-ai/tap/langsmith-cli 1 0%
#10,144 takesako/sigrok/sigrok-firmware-fx2lafw 1 0%
#10,145 ekg2 1 0%
#10,146 mcfly 1 0%
#10,147 spring-io/tap/spring-boot --HEAD 1 0%
#10,148 gpgmepy 1 0%
#10,149 hasansezertasan/tap/nur 1 0%
#10,150 librsvg --HEAD 1 0%
#10,151 nesneros/tap/bash@4.1 1 0%
#10,152 legambiart/birdbox/wtmcp 1 0%
#10,153 nickfraser/tap/flameshot 1 0%
#10,154 jaewoook/nal/gnupg 1 0%
#10,155 wasm-tools 1 0%
#10,156 pedromosquera/tap/tokenjar 1 0%
#10,157 harmonybrew/core/protobuf@29 1 0%
#10,158 jasonhowk/eda-tools/icarus-verilog@12 1 0%
#10,159 lifepillar/appleii/c2t 1 0%
#10,160 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libxml2 --with-openssl 1 0%
#10,161 gomi-source/corebluetooth-go/corebluetoothd 1 0%
#10,162 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-native-compilation --with-starter 1 0%
#10,163 msedit 1 0%
#10,164 autocorrect 1 0%
#10,165 nullvarin/appwhy/appwhy 1 0%
#10,166 execonone/tap/ollama-agent-router 1 0%
#10,167 emmylua_ls 1 0%
#10,168 ccsepbvr/pbvr/qt@6.2.4 1 0%
#10,169 nbytes 1 0%
#10,170 copier 1 0%
#10,171 epheterson/immich-accelerator/immich-accelerator 1 0%
#10,172 abossard/qlcplus/qlcplus 1 0%
#10,173 ble 1 0%
#10,174 bsander/visualping/visualping 1 0%
#10,175 ujj/espin/espin 1 0%
#10,176 matars/gitfetch/gitfetch 1 0%
#10,177 spirometaxas/tap/periodic-table-cli 1 0%
#10,178 cartert27/tap/ticktick-cli --HEAD 1 0%
#10,179 mflowcode/mfc/mfc --HEAD 1 0%
#10,180 dong-labs/tap/dong-inbox 1 0%
#10,181 leoafarias/fvm/fvm@3.1.7 1 0%
#10,182 gitoxide 1 0%
#10,183 lcbasu/g4a/g4a 1 0%
#10,184 kaxing/toolbox/zit 1 0%
#10,185 shaunburdick/tap/token-count 1 0%
#10,186 quantum++ 1 0%
#10,187 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-librist --with-libzvbi --with-openssl --with-srt 1 0%
#10,188 halbotley/tap/timely 1 0%
#10,189 aletepe/tools-tap/disk-usage-visualizer 1 0%
#10,190 rosco-m68k/toolchain/gcc-cross-m68k@12 1 0%
#10,191 filosottile/musl-cross/musl-cross --with-arm --with-i486 --with-riscv64 1 0%
#10,192 scottrigby/tap/claudeman 1 0%
#10,193 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libmodplug --with-libopenmpt --with-libxml2 1 0%
#10,194 jweisner/mdview/mdview 1 0%
#10,195 chenrui333/tap/papis 1 0%
#10,196 chenrui333/tap/minisign 1 0%
#10,197 bashdb 1 0%
#10,198 libgeotiff --HEAD 1 0%
#10,199 harmonybrew/core/redis@8.2 1 0%
#10,200 m0tay/miranda/miranda 1 0%
#10,201 bigbes/tap/gost-engine@3.0.3 1 0%
#10,202 libfido2 --HEAD 1 0%
#10,203 freecad/freecad/med-file@5.0.0_py313 1 0%
#10,204 alexbarton/alex/sendfile 1 0%
#10,205 lucataco/tap/neutts-air-cli 1 0%
#10,206 rockorager/tap/zigdoc --HEAD 1 0%
#10,207 gmrandazzo/gmr/libscientific --HEAD 1 0%
#10,208 mkn025/tap/lambdasearch 1 0%
#10,209 pytorch --HEAD 1 0%
#10,210 rfidresearchgroup/proxmark3/proxmark3 --with-flash --with-generic --with-hf-legicsim 1 0%
#10,211 romankurnovskii/awesome-brew/ffmpeg-iina 1 0%
#10,212 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-dbus --with-glib --with-gnu-head-icon --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-natural-title-bar --with-starter --without-jansson --without-libxml2 1 0%
#10,213 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-jpeg-xl --with-libbluray --with-librsvg --with-rav1e --with-xvid 1 0%
#10,214 pilan-ai/tap/hermes-lang 1 0%
#10,215 rockyluke/devops/drac-kvm 1 0%
#10,216 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libplacebo --with-libvidstab --with-libvmaf --with-opencore-amr --with-rav1e --with-rubberband --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zimg 1 0%
#10,217 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-game-music-emu --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-librsvg --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,218 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm 1 0%
#10,219 spinel-coop/rv-ruby/portable-libyaml@0.2.5 1 0%
#10,220 scttfrdmn/macos-nat-manager/nat-manager 1 0%
#10,221 brad-x/custom/qemu 1 0%
#10,222 bis-code/tap/claw 1 0%
#10,223 zeroc-ice/tap/ice@3.6 1 0%
#10,224 fbeline/luneta/luneta 1 0%
#10,225 n3ssqwik/nexus-ai/nexus-ai 1 0%
#10,226 swas26/cliaud/cliaud 1 0%
#10,227 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-native-compilation 1 0%
#10,228 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libbluray --with-libgsm --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-xvid --with-zimg 1 0%
#10,229 mneves75/tap/ffts-grep 1 0%
#10,230 qo 1 0%
#10,231 icu4c@76 1 0%
#10,232 hahwul/smugglex/smugglex 1 0%
#10,233 cocogitto 1 0%
#10,234 yugabyte/tap/yb-voyager@2026.3.1 1 0%
#10,235 gromgit/fuse/securefs-mac 1 0%
#10,236 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jack --with-libbluray --with-libflite --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-webp --with-zeromq --with-zimg 1 0%
#10,237 cfstras/wol/wol 1 0%
#10,238 pythontyphon/tools/office-pass 1 0%
#10,239 knazarov/qemu-virgl/libangle 1 0%
#10,240 therajushahi/agentmesh/agentmesh 1 0%
#10,241 avpres/formulae/ffmpeg --with-decklink --with-srt 1 0%
#10,242 danger/tap/danger-swift 1 0%
#10,243 openblas --HEAD 1 0%
#10,244 libbsd 1 0%
#10,245 scipy --HEAD 1 0%
#10,246 rustypaste-cli 1 0%
#10,247 kdoctor 1 0%
#10,248 kallepronk/walle/walle 1 0%
#10,249 west 1 0%
#10,250 ibm-aspera-transfer-sdk-macos-arm64 1 0%
#10,251 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-jpeg-xl --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-librist --with-opencore-amr --with-openh264 --with-speex --with-srt --with-two-lame --with-webp --with-whisper-cpp --with-xvid 1 0%
#10,252 homebrew-zathura/zathura/zathura-djvu 1 0%
#10,253 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-libplacebo --with-rav1e 1 0%
#10,254 enigma-game/enigma/enigma --HEAD 1 0%
#10,255 eskelinenantti/cli/latest-kotlin-lsp 1 0%
#10,256 shivammathur/extensions/oauth@8.6 1 0%
#10,257 shivammathur/extensions/memcached@8.6 1 0%
#10,258 shivammathur/extensions/mcrypt@8.6 1 0%
#10,259 shivammathur/extensions/maxminddb@8.6 1 0%
#10,260 alexsds/tap/ade 1 0%
#10,261 ingress2gateway 1 0%
#10,262 shivammathur/extensions/raphf@8.6 1 0%
#10,263 try 1 0%
#10,264 bear10591/tap/asset-tools 1 0%
#10,265 llvm@21 --HEAD 1 0%
#10,266 moonfruit/tap/ethr 1 0%
#10,267 sqitchers/sqitch/sqitch --with-vertica-support 1 0%
#10,268 mdv 1 0%
#10,269 andrewdongminyoo/brew-snapshot/brew-snapshot 1 0%
#10,270 andantissimo/wxmac/wxmac@3.1 --with-static 1 0%
#10,271 pdftilecut 1 0%
#10,272 msgpack --HEAD 1 0%
#10,273 eduardoteles17/tap/postgresql@9.4 1 0%
#10,274 eduardoteles17/tap/postgresql@9.6 1 0%
#10,275 jfrog-cli --HEAD 1 0%
#10,276 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-mac-metal --with-native-compilation --with-starter 1 0%
#10,277 libswiftnav 1 0%
#10,278 krunkit 1 0%
#10,279 cartr/qt4/openssl@1.0 --with-universal 1 0%
#10,280 ocamlbuild 1 0%
#10,281 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libflite --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-zeromq --with-zimg 1 0%
#10,282 maenpaa24/repo/gnutls 1 0%
#10,283 satellite-tracker 1 0%
#10,284 mozjpeg 1 0%
#10,285 xmake 1 0%
#10,286 openbao --HEAD 1 0%
#10,287 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-libsoxr --with-libvidstab --with-srt --with-tesseract 1 0%
#10,288 harmonybrew/core/aom 1 0%
#10,289 cxwx/cxbrew/vecmath 1 0%
#10,290 scaryrawr/formulae/omlx --with-grammar --with-image 1 0%
#10,291 railwaycat/emacsmacport/emacs-mac@28 --with-native-compilation 1 0%
#10,292 sshguard 1 0%
#10,293 shivammathur/php/php@8.2-zts 1 0%
#10,294 bitcoin 1 0%
#10,295 ikaro1192/tap/paninfraspec 1 0%
#10,296 ginkgo 1 0%
#10,297 clippy 1 0%
#10,298 signalwire/signalwire/signalwire-c 1 0%
#10,299 lookup+media 1 0%
#10,300 cardmagic/tap/messages 1 0%
#10,301 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-tensorflow 1 0%
#10,302 scaryrawr/formulae/claudio 1 0%
#10,303 macos-trash 1 0%
#10,304 gif2png 1 0%
#10,305 mad0x20wizard/test/test-sharp 1 0%
#10,306 qbs 1 0%
#10,307 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,308 harmonybrew/core/libnsl 1 0%
#10,309 lazydocker 1 0%
#10,310 dweekly/ftr/ftr 1 0%
#10,311 saldl 1 0%
#10,312 nshipster/formulae/swift-syntax-highlight 1 0%
#10,313 ryanfb/alicevision/alicevision 1 0%
#10,314 shivammathur/php/php@8.1-zts 1 0%
#10,315 lescanauxdiscrets/tap/zvbi 1 0%
#10,316 nejohnson2/sdr/gr-baz --HEAD 1 0%
#10,317 trezor-agent 1 0%
#10,318 tchamp1912/openleash/openleash --HEAD 1 0%
#10,319 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libflite --with-openssl --with-webp 1 0%
#10,320 slowhttptest 1 0%
#10,321 kamal-proxy 1 0%
#10,322 k06a/tap/macpow 1 0%
#10,323 vizeireann/tools/retrnote 1 0%
#10,324 bl4cc4t/vsplugins/vsp-addgrain --HEAD 1 0%
#10,325 bandcamp-dl --HEAD 1 0%
#10,326 mcpm 1 0%
#10,327 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-dbus --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-no-title-bars --with-starter --with-xwidgets 1 0%
#10,328 educelab/code/openabf 1 0%
#10,329 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,330 libxkbcommon 1 0%
#10,331 railwaycat/emacsmacport/emacs-mac@30exp --HEAD --with-ctags --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-native-compilation --with-unlimited-select --with-xwidgets 1 0%
#10,332 guioum/tap/ocr-pipeline 1 0%
#10,333 railwaycat/emacsmacport/emacs-mac@28 --with-modern-icon --with-native-compilation --with-natural-title-bar --with-starter 1 0%
#10,334 jhseo-git/tap/abc-notify --HEAD 1 0%
#10,335 openblas64 --HEAD 1 0%
#10,336 broberson/xgminer/bfgminer 1 0%
#10,337 aeschylus/clipd/clipd 1 0%
#10,338 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-librsvg --with-mac-metal --with-native-comp 1 0%
#10,339 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-sexy-icon --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-no-title-bars --with-starter --with-xwidgets --without-modules 1 0%
#10,340 hiimkimchi/ytdlpgui/ytdlpgui 1 0%
#10,341 dyngraphlab/dyngraphlab/dynmatch 1 0%
#10,342 osrf/simulation/gz-fuel-tools9 --HEAD 1 0%
#10,343 bluetoothconnector 1 0%
#10,344 cljfmt 1 0%
#10,345 octomap 1 0%
#10,346 pointfreeco/formulae/swift-format@5.7 1 0%
#10,347 pkulev/riru/sex --HEAD 1 0%
#10,348 openscad/tap/osmesa 1 0%
#10,349 solargraph 1 0%
#10,350 harmonybrew/core/rainbarf 1 0%
#10,351 joglomedia/brewery/curl-impersonate 1 0%
#10,352 hangarbay/tap/sheen 1 0%
#10,353 vdplabs/tap/pantry 1 0%
#10,354 forcequitos/brew/netcaps 1 0%
#10,355 harmonybrew/core/mark 1 0%
#10,356 harmonybrew/core/vim 1 0%
#10,357 boa 1 0%
#10,358 blakek/blakek/pomodoro 1 0%
#10,359 mrreasonable/tap/job-sluice 1 0%
#10,360 pycparser 1 0%
#10,361 silentglasses/warp/warp-terminal 1 0%
#10,362 rapidraw 1 0%
#10,363 shivammathur/extensions/vips@8.6 1 0%
#10,364 zabbix --HEAD 1 0%
#10,365 lexicon 1 0%
#10,366 sacad 1 0%
#10,367 soramikan/tap/lnako 1 0%
#10,368 akhil-gautam/hivemind/hivemind 1 0%
#10,369 bitpeppr/formulae/toknt 1 0%
#10,370 zezoo123/tap/terminal-pet 1 0%
#10,371 dub --HEAD 1 0%
#10,372 ncspot 1 0%
#10,373 zpaq 1 0%
#10,374 knutmann/adium/adium 1 0%
#10,375 takesako/sigrok/libsigrokdecode --HEAD 1 0%
#10,376 takesako/sigrok/libsigrok 1 0%
#10,377 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,378 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,379 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libbs2b --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,380 homebrew-ffmpeg/ffmpeg/ffmpeg --with-openjpeg 1 0%
#10,381 cdrdao 1 0%
#10,382 shivammathur/extensions/couchbase@7.4 1 0%
#10,383 python-freethreading --HEAD 1 0%
#10,384 toast 1 0%
#10,385 jeongjaesoon/tap/hintvim 1 0%
#10,386 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,387 kreeblah/imsprog-tap/imsprog 1 0%
#10,388 skozar/tap/keepalive 1 0%
#10,389 polyml 1 0%
#10,390 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libbluray --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-srt --with-webp --with-xvid 1 0%
#10,391 svtplay-dl 1 0%
#10,392 vgmstream 1 0%
#10,393 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-ggml --with-jpeg-xl --with-libflite --with-librsvg --with-libtensorflow --with-openal-soft --with-openh264 --with-openssl@3 --with-rtmpdump --with-speex --with-tensorflow --with-webp --with-whisper-cpp --with-zimg 1 0%
#10,394 mubit-ai/minima/minima 1 0%
#10,395 ome/alt/bioformats@7.1 1 0%
#10,396 sacharya1980/flite/flite 1 0%
#10,397 boardwalk-labs/tap/boardwalk 1 0%
#10,398 railwaycat/emacsmacport/emacs-mac@30exp --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-no-title-bars --with-starter 1 0%
#10,399 lifepillar/appleii/mach-kernel-cadius 1 0%
#10,400 xcodesorg/made/xcodes --with-postgres-support 1 0%
#10,401 llvm-hs/llvm/llvm-6.0 1 0%
#10,402 la5nta/tap/pat --HEAD 1 0%
#10,403 axu2/kindletool/kindletool 1 0%
#10,404 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-ggml --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,405 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libbluray --with-libbs2b --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,406 ryanlevy/tap/maxent 1 0%
#10,407 ec 1 0%
#10,408 rhyumiranda/tap/sesame 1 0%
#10,409 bucabay/tap/seal 1 0%
#10,410 hackerwarellc/tap/continuity 1 0%
#10,411 libtar 1 0%
#10,412 libowfat 1 0%
#10,413 libnids 1 0%
#10,414 libmps 1 0%
#10,415 libmaa 1 0%
#10,416 liblockfile 1 0%
#10,417 libident 1 0%
#10,418 libcuefile 1 0%
#10,419 tudorandrei/muzik/muzik 1 0%
#10,420 benmoose/tap/fn-utils 1 0%
#10,421 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,422 cxwx/cxbrew/field-reflection 1 0%
#10,423 mylovelytools/managedssh/managedssh 1 0%
#10,424 papis 1 0%
#10,425 translate-toolkit 1 0%
#10,426 ilovevideoeditor/tap/ilovevideoeditor 1 0%
#10,427 t1lib 1 0%
#10,428 restream/reindexer/reindexer --HEAD 1 0%
#10,429 supertux --HEAD 1 0%
#10,430 streamvbyte 1 0%
#10,431 tailcat --HEAD 1 0%
#10,432 harmonybrew/core/masscan 1 0%
#10,433 notmuch --HEAD 1 0%
#10,434 nullvarin/macdock/macdock 1 0%
#10,435 brewsci/science/sailfish 1 0%
#10,436 brewsci/science/rapsearch2 1 0%
#10,437 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,438 brewsci/science/fastx_toolkit 1 0%
#10,439 brewsci/science/ea-utils 1 0%
#10,440 brewsci/science/dgtal 1 0%
#10,441 archey4 1 0%
#10,442 protoc-gen-grpc-web 1 0%
#10,443 ash/rakupp/rakupp 1 0%
#10,444 mistydemeo/digipres/fluxengine 1 0%
#10,445 opm/opm/libf2c 1 0%
#10,446 nvinnikov/dspl/dspl 1 0%
#10,447 open-adventure 1 0%
#10,448 rain 1 0%
#10,449 superorange0707/tap/project-brain 1 0%
#10,450 tifrueh/mytap/md2atxt --HEAD 1 0%
#10,451 libsbsms 1 0%
#10,452 fmenezes/tap/remill 1 0%
#10,453 wstunnel --HEAD 1 0%
#10,454 tigger-developer/tap/superscale 1 0%
#10,455 roelofrossouw/sc/simply-cpp 1 0%
#10,456 media-control 1 0%
#10,457 swc 1 0%
#10,458 reshape 1 0%
#10,459 pipelight 1 0%
#10,460 mejistus/mona/oplire 1 0%
#10,461 johnrushwrs/i386-elf-toolchain/i386-elf-binutils 1 0%
#10,462 distcc --HEAD 1 0%
#10,463 kyverno 1 0%
#10,464 just --HEAD 1 0%
#10,465 cavaliercoder/tap/buzzkill 1 0%
#10,466 harmonybrew/core/railway 1 0%
#10,467 sheldon 1 0%
#10,468 vasylherman/tap/break-reminder 1 0%
#10,469 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,470 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,471 jbig2enc 1 0%
#10,472 harmonybrew/core/openjdk@25 1 0%
#10,473 oxund/morph/morph 1 0%
#10,474 harmonybrew/core/shadcn 1 0%
#10,475 dbxcli 1 0%
#10,476 xberg-io/tap/alef 1 0%
#10,477 fffelix-huang/tap/punch 1 0%
#10,478 libp11 1 0%
#10,479 loschenbd/tokentrail/tokentrail 1 0%
#10,480 tn5250 1 0%
#10,481 eyhn/tap/kwwk --HEAD 1 0%
#10,482 yikox/tap/quicklauncher 1 0%
#10,483 zathura-pdf-poppler 1 0%
#10,484 momhq/tap/mom 1 0%
#10,485 szmickhuang/tap/crush 1 0%
#10,486 harmonybrew/core/libtorrent-rakshasa 1 0%
#10,487 mietzen/tap/keepassxc-cli 1 0%
#10,488 sftpgo 1 0%
#10,489 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,490 kenryu42/tap/ralph-review 1 0%
#10,491 osmfilter 1 0%
#10,492 bigloo --HEAD 1 0%
#10,493 crossfire-client --HEAD 1 0%
#10,494 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-librist --with-libsoxr --with-libssh --with-libxml2 --with-libzvbi --with-openssl --with-rubberband --with-srt --with-two-lame --with-zeromq --with-zimg 1 0%
#10,495 tillmanbuildstech/tap/hourglass 1 0%
#10,496 libyang 1 0%
#10,497 remreren/ristretto/ristretto 1 0%
#10,498 harmonybrew/core/net-tools 1 0%
#10,499 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,500 cirsever/tap/did-tibo-reset 1 0%
#10,501 aisipos/libgnomeui/etherape 1 0%
#10,502 carapace 1 0%
#10,503 hoonkim/tap/webcat 1 0%
#10,504 net-snmp --HEAD 1 0%
#10,505 geckodriver --HEAD 1 0%
#10,506 menhir 1 0%
#10,507 mapproxy 1 0%
#10,508 melqtx/tap/tork 1 0%
#10,509 ohmguru/tap/appstore-cli 1 0%
#10,510 rdkit/rdkit/rdkit --with-postgresql 1 0%
#10,511 tideline-studio/tap/sourcekit-xcode-bsp 1 0%
#10,512 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-ggml --with-jpeg-xl --with-libflite --with-libplacebo --with-librist --with-librsvg --with-libtensorflow --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-speex --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-zimg 1 0%
#10,513 kotofetch 1 0%
#10,514 arvatoaws-labs/tap/sfn-ng 1 0%
#10,515 abinit/tap/abinit --with-netcdf-fortran-parallel 1 0%
#10,516 d12frosted/emacs-plus/emacs-plus@32 --with-compress-install --with-dbus --with-debug --with-mailutils --with-xwidgets 1 0%
#10,517 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-dbus --with-imagemagick --with-native-comp --with-natural-title-bar 1 0%
#10,518 mgkennard/formulae/todotxt2org 1 0%
#10,519 nnn 1 0%
#10,520 jhladik/formulas/icestorm 1 0%
#10,521 outsinre/wrk2/wrk2 1 0%
#10,522 luajit --HEAD 1 0%
#10,523 filosottile/musl-cross/musl-cross --with-mipsel --without-x86_64 1 0%
#10,524 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-starter --with-unlimited-select 1 0%
#10,525 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-mailutils 1 0%
#10,526 d12frosted/emacs-plus/emacs-plus@29 --with-nobu417-big-sur-icon 1 0%
#10,527 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-mailutils --with-nobu417-big-sur-icon 1 0%
#10,528 d12frosted/emacs-plus/emacs-plus@29 --with-ctags --with-dbus --with-debug --with-imagemagick --with-mailutils --with-nobu417-big-sur-icon --with-xwidgets 1 0%
#10,529 aaratha/emacs-plus/emacs-plus@30 --with-modern-alecive-flatwoken-icon --with-xwidgets 1 0%
#10,530 slp/virtiofs/qemu-vhost 1 0%
#10,531 httping 1 0%
#10,532 cbmc 1 0%
#10,533 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-comp 1 0%
#10,534 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-imagemagick --with-mailutils 1 0%
#10,535 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-xwidgets 1 0%
#10,536 portmidi 1 0%
#10,537 labctl 1 0%
#10,538 automoto/gmfind/gmfind 1 0%
#10,539 4rays/tap/ask-deepwiki 1 0%
#10,540 dblab 1 0%
#10,541 ensembl/ensembl/orthofinder 1 0%
#10,542 tdiderich/claudoist/claudoist 1 0%
#10,543 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libvidstab --with-libvmaf --with-svt-av1 --with-webp --with-zimg 1 0%
#10,544 uditanshutomar/custosaxopenclaw/custosa 1 0%
#10,545 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-libplacebo --with-rubberband --with-srt --with-webp 1 0%
#10,546 homebrew-ffmpeg/ffmpeg/ffmpeg --with-srt --with-svt-av1 1 0%
#10,547 gamerwaves/slash/slash 1 0%
#10,548 ralph-orchestrator 1 0%
#10,549 petsc-complex 1 0%
#10,550 niborg/wralph/wralph 1 0%
#10,551 libnl 1 0%
#10,552 termos-dev/termos/termos 1 0%
#10,553 freecad/freecad/shiboken2@5.15.11 1 0%
#10,554 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libdvdnav --with-libdvdread --with-libmodplug --with-libssh --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,555 khal 1 0%
#10,556 vulkan-validationlayers --HEAD 1 0%
#10,557 malatenszki/agent-bridge/agent-bridge-daemon 1 0%
#10,558 muxi-ai/tap/muxi 1 0%
#10,559 portsmf 1 0%
#10,560 ansatzx/mokit/mokit --with-py39 1 0%
#10,561 ansatzx/mokit/mokit --HEAD --with-py39 1 0%
#10,562 romankurnovskii/awesome-brew/mpv 1 0%
#10,563 knight42/tap/krelay --HEAD 1 0%
#10,564 rumdl 1 0%
#10,565 cutbox/cutbox/cutbox 1 0%
#10,566 sqliteodbc 1 0%
#10,567 nghttp2 1 0%
#10,568 r1sim/essentia/gaia 1 0%
#10,569 bear10591/tap/mpv 1 0%
#10,570 shaunplee/asic/tk-with-x 1 0%
#10,571 snyk-cli 1 0%
#10,572 aaratha/emacs-plus/emacs-plus@30 --with-imagemagick --with-mailutils --with-modern-icon --with-xwidgets 1 0%
#10,573 jjbreen3ki/tap/mdbtools-ki 1 0%
#10,574 dnote 1 0%
#10,575 filosottile/musl-cross/musl-cross --with-mips --without-aarch64 --without-x86_64 1 0%
#10,576 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libcaca --with-libsoxr --with-libssh --with-svt-av1 1 0%
#10,577 shaunplee/asic/magic-vlsi 1 0%
#10,578 iloveitaly/tap/hyper-focus 1 0%
#10,579 vivekg13186/z/z-lang 1 0%
#10,580 tfcollins/formulae/libglade 1 0%
#10,581 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,582 houmain/tap/spright --HEAD 1 0%
#10,583 cmecca/moonlab/plan9port 1 0%
#10,584 certsync 1 0%
#10,585 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-xwidgets 1 0%
#10,586 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libssh --with-libxml2 --with-openh264 --with-openssl@3 --with-rtmpdump --with-webp --with-whisper-cpp 1 0%
#10,587 patelnav/ctrlspeak/ctrlspeak --with-nvidia --with-whisper 1 0%
#10,588 openresty/brew/openresty-openssl111 1 0%
#10,589 cpufetch 1 0%
#10,590 gitingest 1 0%
#10,591 stackery/tap/stackery-cli 1 0%
#10,592 moc --HEAD 1 0%
#10,593 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libssh --with-openssl --with-tensorflow --with-two-lame 1 0%
#10,594 codecademy-engineering/bootstrap/kubernetes-cli@1.27 1 0%
#10,595 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-debug --with-imagemagick --with-mailutils --with-modern-orange-icon --with-xwidgets 1 0%
#10,596 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-x11 1 0%
#10,597 mreedthings/tap/moneymade 1 0%
#10,598 jmuelbert/qtifw/qtifw 1 0%
#10,599 amolenk/admitto/admitto-cli 1 0%
#10,600 php@7.3 1 0%
#10,601 ddd 1 0%
#10,602 foot 1 0%
#10,603 shivammathur/extensions/yaml@8.6 1 0%
#10,604 brewsci/bio/filtlong 1 0%
#10,605 sarafanovn/tap/sfxc-cli 1 0%
#10,606 viddy 1 0%
#10,607 admesh/admesh/admeshgui --HEAD 1 0%
#10,608 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,609 humanlog 1 0%
#10,610 glib --with-imagemagick --with-xwidgets 1 0%
#10,611 itsnauman/whyfi/whyfi 1 0%
#10,612 idleberg/nsisbi/nsisbi@3.01.1 1 0%
#10,613 neved4/tap/weechat-lite 1 0%
#10,614 jaewoook/nal/gdb 1 0%
#10,615 vhs 1 0%
#10,616 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-mailutils 1 0%
#10,617 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-imagemagick --with-mailutils --with-modern-purple-flat-icon --with-xwidgets 1 0%
#10,618 archit0/termi/termi 1 0%
#10,619 staticcheck 1 0%
#10,620 monetdb 1 0%
#10,621 pgsty/infra/barn --HEAD 1 0%
#10,622 cklukas/ckmux/ck-utilities 1 0%
#10,623 mprocs 1 0%
#10,624 egctl 1 0%
#10,625 anatol/tap/booklight --HEAD 1 0%
#10,626 energy 1 0%
#10,627 gsong2014/sdr/soapybladerf 1 0%
#10,628 utf8proc --HEAD 1 0%
#10,629 libtpms 1 0%
#10,630 pass-import --HEAD 1 0%
#10,631 jorji49/tap/streamtop --HEAD 1 0%
#10,632 respawn-app/tap/ksrc 1 0%
#10,633 dialog-if/brew/aamachine 1 0%
#10,634 cssr-tools/opm/opm-simulators 1 0%
#10,635 harmonybrew/core/tirith 1 0%
#10,636 jonmichaels/tap/sr 1 0%
#10,637 jiqiren/tap/sloptoot 1 0%
#10,638 libjwt 1 0%
#10,639 shivammathur/core-intel/libpsl 1 0%
#10,640 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-openssl 1 0%
#10,641 lrk/rlottie/rlottie 1 0%
#10,642 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-sexy-icon --with-imagemagick --with-librsvg --with-native-compilation --with-unlimited-select 1 0%
#10,643 musikcube 1 0%
#10,644 bfontaine/utils/gzsize 1 0%
#10,645 gomi-source/corebluetooth-go/corebluetoothd --HEAD 1 0%
#10,646 libvpl 1 0%
#10,647 xinding33/tap/ripple 1 0%
#10,648 bomberfish/kde/dolphin 1 0%
#10,649 hack-different/jailbreak/frida-tools 1 0%
#10,650 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-mailutils --with-xwidgets 1 0%
#10,651 brewsci/bio/openstructure 1 0%
#10,652 dehancer/brew/giflib_dehancer 1 0%
#10,653 d12frosted/emacs-plus/emacs-plus@30 --with-EmacsIcon1-icon --with-dbus --with-imagemagick --with-mailutils 1 0%
#10,654 qtvirtualkeyboard 1 0%
#10,655 gcc --with-glib --with-imagemagick --with-librsvg --with-native-comp --with-no-title-bars --with-xwidgets 1 0%
#10,656 d12frosted/emacs-plus/emacs-plus@29 --with-modern-doom3-icon --with-native-comp --with-xwidgets 1 0%
#10,657 especialista-seta/nostromo/nostromo 1 0%
#10,658 d12frosted/emacs-plus/emacs-plus@30 --with-retro-gnu-meditate-levitate-icon 1 0%
#10,659 promtail 1 0%
#10,660 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libaribb24 --with-libaribcaption --with-libplacebo --with-libsoxr --with-openh264 --with-openjpeg --with-openssl --with-rubberband --with-srt --with-webp --with-xvid --with-zimg 1 0%
#10,661 stek29/idevice/libfragmentzip --HEAD 1 0%
#10,662 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-librsvg --with-native-compilation --with-spacemacs-icon --with-starter 1 0%
#10,663 huzaifaiftikhar/openssl/openssl@1.0 1 0%
#10,664 haskell-language-server --HEAD 1 0%
#10,665 sqlcipher --HEAD 1 0%
#10,666 osrf/simulation/gz-math9 1 0%
#10,667 bow-swift/bow/bow-openapi 1 0%
#10,668 kmarker1101/macdev/macdev 1 0%
#10,669 cc65 1 0%
#10,670 yznki/tap/glidepath 1 0%
#10,671 astgen 1 0%
#10,672 libchewing 1 0%
#10,673 ttl 1 0%
#10,674 redis-developer/core/redis 1 0%
#10,675 soilros/opm/resinsight --HEAD 1 0%
#10,676 jumpyvi/morebrew/libvirt-full 1 0%
#10,677 d12frosted/emacs-plus/emacs-plus@29 --with-ctags --with-dbus --with-imagemagick --with-mailutils --with-native-comp 1 0%
#10,678 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jpeg-xl --with-librsvg --with-openapv --with-openh264 --with-openjpeg --with-openvino --with-rav1e --with-rubberband --with-svt-av1 --with-tesseract --with-webp --with-whisper-cpp --with-xvid 1 0%
#10,679 ja7ad/tap/hydra 1 0%
#10,680 libfreenect 1 0%
#10,681 shivammathur/extensions/swoole@8.4 1 0%
#10,682 js-recon/tap/js-recon 1 0%
#10,683 shivammathur/extensions/swoole@7.4 --HEAD 1 0%
#10,684 bbenchen/emacs-plus/emacs-plus@31 --with-savchenkovaleriy-big-sur-icon --with-xwidgets 1 0%
#10,685 glslviewer 1 0%
#10,686 tnishinaga/sigrok/libsigrokdecode 1 0%
#10,687 diffutils 1 0%
#10,688 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-modern-doom-icon 1 0%
#10,689 mdave/nektar/nektar-tinyxml 1 0%
#10,690 hasnep/tap/meta-package-manager 1 0%
#10,691 bomberfish/kde/kf5-kdoctools 1 0%
#10,692 bl4cc4t/vsplugins/vsp-vmaf --HEAD 1 0%
#10,693 pari 1 0%
#10,694 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,695 matplotplusplus 1 0%
#10,696 sparkworx/stuff/mineru 1 0%
#10,697 isa/tap/chatter 1 0%
#10,698 amar1729/essentia/essentia --HEAD --without-python 1 0%
#10,699 bandcamp-dl 1 0%
#10,700 mit112/bridge/bridge --HEAD 1 0%
#10,701 logcat-io/tap/trove 1 0%
#10,702 conversence/conversencetaps/postgresql_plpy@17 1 0%
#10,703 tiger3645/tap/light-notifier 1 0%
#10,704 snowflake 1 0%
#10,705 win0na/tap/macdefaultbrowser 1 0%
#10,706 cbenhagen/video/libmxfpp 1 0%
#10,707 mmark 1 0%
#10,708 aws-c-sdkutils 1 0%
#10,709 bash-completion 1 0%
#10,710 zalt50/core/ollama 1 0%
#10,711 sorafujitani/tap/hermes 1 0%
#10,712 nfdump 1 0%
#10,713 conceptproto/tap/reef 1 0%
#10,714 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libvmaf --with-libzvbi --with-rtmpdump --with-srt --with-two-lame 1 0%
#10,715 alexintosh/specchio/specchio 1 0%
#10,716 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --without-cocoa 1 0%
#10,717 libaacs --HEAD 1 0%
#10,718 libbitcoin-consensus 1 0%
#10,719 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jpeg-xl --with-libbluray --with-libcaca --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zimg 1 0%
#10,720 gromgit/tap/colibri 1 0%
#10,721 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 1 0%
#10,722 brewsci/bio/reviewer 1 0%
#10,723 cubejs-cli 1 0%
#10,724 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,725 aicommit2 1 0%
#10,726 twio142/tap/systemctl-tui 1 0%
#10,727 liquidlm/tap/liquidlm 1 0%
#10,728 tenequm/tap/cuttle 1 0%
#10,729 geeqie 1 0%
#10,730 joshrotenberg/brew/mdbook-lint 1 0%
#10,731 preloopdev/somac/somac 1 0%
#10,732 schneidermayer/tap/catmd 1 0%
#10,733 kdoctools 1 0%
#10,734 sowderca/tap/gtk-engine-murrine 1 0%
#10,735 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,736 cssr-tools/opm/resinsight --HEAD 1 0%
#10,737 llmfit --HEAD 1 0%
#10,738 agentworkforce/ai-hist/ai-hist 1 0%
#10,739 harmonybrew/core/lld@22 1 0%
#10,740 micasa 1 0%
#10,741 flint-engine/flint/flint 1 0%
#10,742 ayushanuj/tap/restaurant-ai 1 0%
#10,743 patravishek/memex/memex 1 0%
#10,744 erlang@27 1 0%
#10,745 arcadi4/tap/vite-plus 1 0%
#10,746 chris-wood-mo/poketerm/poketerm 1 0%
#10,747 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-debug --with-imagemagick --with-mailutils 1 0%
#10,748 nanaian/brew/mips-linux-gnu-binutils 1 0%
#10,749 x86_64-linux-gnu-binutils 1 0%
#10,750 vpn-slice --HEAD 1 0%
#10,751 bagel 1 0%
#10,752 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,753 willsawyerrrr/tap/tether 1 0%
#10,754 tnftp 1 0%
#10,755 benbenbang/forge/uv-shell 1 0%
#10,756 c10t 1 0%
#10,757 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libsoxr 1 0%
#10,758 mcrundo/franklin/franklin-book 1 0%
#10,759 fajarhide/omni/omni 1 0%
#10,760 tavianator/tap/bfs 1 0%
#10,761 tigreau/catclip/catclip 1 0%
#10,762 ghc@9.6 1 0%
#10,763 crewmux/tap/crewmux --HEAD 1 0%
#10,764 hypopg 1 0%
#10,765 shivammathur/extensions/lua@8.0 1 0%
#10,766 brewsci/bio/hisat2 1 0%
#10,767 gromgit/fuse/s3-backer-mac 1 0%
#10,768 proxmox-mac-guest/spice/spice-vdagent 1 0%
#10,769 onlyliujiangtao/tap/frpc 1 0%
#10,770 windusth/tap/music-tui --HEAD 1 0%
#10,771 libgedit-gfls 1 0%
#10,772 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,773 ffmpeg_mhee 1 0%
#10,774 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-emacs-big-sur-icon --with-glib --with-librsvg --with-mac-metal --with-native-comp --with-natural-title-bar --with-no-title-bars 1 0%
#10,775 jlp04/homebrew/libglade 1 0%
#10,776 sabiql 1 0%
#10,777 theapplegates/kleopatra6mac/kf6-kjobwidgets 1 0%
#10,778 sflinter/tap/cloud-conductor 1 0%
#10,779 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libvmaf --with-libxml2 --with-libzvbi --with-speex --with-srt --with-webp --with-xvid --with-zimg 1 0%
#10,780 jayanaxhf/zathura/zathura --with-synctex 1 0%
#10,781 nclandrei/tap/mcpsmith 1 0%
#10,782 skepticfx/tap/sole 1 0%
#10,783 denji/nginx/nginx-full --with-extended-status-module --with-rtmp-module --with-status 1 0%
#10,784 stuntcoders/meta-ads-cli/meta-ads-cli 1 0%
#10,785 likesjx/philotic/aiua 1 0%
#10,786 khakhasshi/tap/macdevtools 1 0%
#10,787 shivammathur/extensions/mcrypt@8.5 1 0%
#10,788 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation 1 0%
#10,789 bgunnarsson/binman/binman 1 0%
#10,790 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --without-modules 1 0%
#10,791 periphery --HEAD 1 0%
#10,792 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libplacebo --with-openvino --with-tensorflow --with-zimg 1 0%
#10,793 jhalter/mobius-hotline-server/mobius-hotline-server 1 0%
#10,794 folly --HEAD 1 0%
#10,795 hidapi 1 0%
#10,796 flix 1 0%
#10,797 quantumentangledandy/taps/neolink 1 0%
#10,798 morpheus-lab/morpheus-versions/morpheus@2.3.3 1 0%
#10,799 ailabph/orchestrator-auto/planner-auto 1 0%
#10,800 d12frosted/emacs-plus/emacs-plus@30 --HEAD --with-modern-papirus-icon --with-xwidgets 1 0%
#10,801 pieces-cli 1 0%
#10,802 tkersey/tap/cas 1 0%
#10,803 apache-arrow --HEAD 1 0%
#10,804 tamada/tap/spellout 1 0%
#10,805 eigen --HEAD 1 0%
#10,806 yang-yiming/tap/ccrl 1 0%
#10,807 thesmokinator/hledger-textual/hledger-textual 1 0%
#10,808 timescale/tap/ox 1 0%
#10,809 swiftdocorg/formulae/swift-doc --HEAD 1 0%
#10,810 tecolicom/tap/getoptlong-bash 1 0%
#10,811 g-dos/gedos/gedos 1 0%
#10,812 micromamba --HEAD 1 0%
#10,813 nnao45/pexpo/pexpo 1 0%
#10,814 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-openapv --with-openh264 --with-srt 1 0%
#10,815 moonfruit/tap/sing-box-beta 1 0%
#10,816 z80oolong/mlterm/ptyxis-mlterm 1 0%
#10,817 moonfruit/tap/sing-box-ref1nd 1 0%
#10,818 khezen/codespy/codespy 1 0%
#10,819 yottayoshida/tap/lkr 1 0%
#10,820 bazelbuild/tap/bazel@6 1 0%
#10,821 davidchall/hep/partons 1 0%
#10,822 immudb 1 0%
#10,823 hhushhas/tap/skillbox 1 0%
#10,824 gaoscode/tap/memwing 1 0%
#10,825 dexter-lsp 1 0%
#10,826 remotivelabs/remotivelabs-cli/remotivelabs-cli 1 0%
#10,827 pascalweiss/tap/yt-transcribe 1 0%
#10,828 serkanemir/tap/cmd-v 1 0%
#10,829 ffleming/formulae/nethack-nao 1 0%
#10,830 rumoca 1 0%
#10,831 ainyc/canonry/canonry 1 0%
#10,832 nexepic/zyx/zyx 1 0%
#10,833 abilian/tap/prezo 1 0%
#10,834 elcafe7/lex/lex 1 0%
#10,835 brewsci/science/plink 1 0%
#10,836 container-image 1 0%
#10,837 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libssh 1 0%
#10,838 fasttext 1 0%
#10,839 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-imagemagick --with-mailutils --with-modern-nuvola-icon --with-xwidgets 1 0%
#10,840 opencc 1 0%
#10,841 ifopt 1 0%
#10,842 cubing/cubing/twsearch --HEAD 1 0%
#10,843 libprelude 1 0%
#10,844 cloudflared --HEAD 1 0%
#10,845 zuban 1 0%
#10,846 osrf/simulation/sdformat15 1 0%
#10,847 mcp-grafana --HEAD 1 0%
#10,848 tomtom-international/taps/pkg-config@0.29.2 1 0%
#10,849 denji/nginx/nginx-full --with-mod-zip-module 1 0%
#10,850 lld@20 1 0%
#10,851 wossfoss/vapoursynth/vapoursynth-fillborders 1 0%
#10,852 spinsoft-transcription/apps/sign-language-recorder 1 0%
#10,853 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,854 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,855 ivantokar/tap/hokusai 1 0%
#10,856 lollicoolhu/tap/mitmproxyng 1 0%
#10,857 soohanpark/tap/removebg 1 0%
#10,858 chocolatey 1 0%
#10,859 l123 1 0%
#10,860 twine 1 0%
#10,861 srt 1 0%
#10,862 chenrui333/tap/claude-context-mcp 1 0%
#10,863 luvit 1 0%
#10,864 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-srt --with-webp 1 0%
#10,865 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-openjpeg --with-openssl --with-rtmpdump --with-srt --with-webp 1 0%
#10,866 ertiz82/gitai/git-ai 1 0%
#10,867 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-librsvg --with-spacemacs-icon --with-starter 1 0%
#10,868 rocksdb --HEAD 1 0%
#10,869 d12frosted/emacs-plus/emacs-plus@30 --with-debug --with-imagemagick --with-modern-icon 1 0%
#10,870 cshlsiepellab/tools/phast 1 0%
#10,871 dvcrn/formulas/chainenv 1 0%
#10,872 libuuid 1 0%
#10,873 vantage-sh/tap/vantage-mcp-server 1 0%
#10,874 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-elrumo1-icon --with-imagemagick --with-mailutils --with-xwidgets 1 0%
#10,875 mitre/saf/saf-cli 1 0%
#10,876 knope-dev/tap/knope --HEAD 1 0%
#10,877 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libplacebo 1 0%
#10,878 glib --HEAD --with-tensorflow 1 0%
#10,879 gromgit/fuse/fusehfs-mac 1 0%
#10,880 coin-or-tools/coinor/dylp 1 0%
#10,881 anthumchris/gnupg/gnupg@2.5 1 0%
#10,882 jdillon/planet57/forge 1 0%
#10,883 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-imagemagick --with-modern-doom3-icon --with-no-frame-refocus 1 0%
#10,884 d12frosted/emacs-plus/emacs-plus@29 --with-modern-doom-icon 1 0%
#10,885 gnu-go --HEAD 1 0%
#10,886 d12frosted/emacs-plus/emacs-plus@30 --with-c9rgreen-sonoma-icon --with-debug --with-xwidgets 1 0%
#10,887 teitei-tk/phash/phash 1 0%
#10,888 dlr-ts/sumo/sumo@1.10.0 1 0%
#10,889 delve --HEAD 1 0%
#10,890 roboalchemist/perplexity-cli/perplexity-cli 1 0%
#10,891 roboalchemist/tap/trckr 1 0%
#10,892 kdecraft 1 0%
#10,893 amber-lang/amber/amber-lang --HEAD 1 0%
#10,894 ysys143/open-scribe/open-scribe 1 0%
#10,895 ivoronin/taps/ec2ssh 1 0%
#10,896 node@22 --HEAD 1 0%
#10,897 d12frosted/emacs-plus/emacs-plus@30 --with-modern-sexy-v2-icon --with-xwidgets 1 0%
#10,898 webdav 1 0%
#10,899 amin-abouee/formulae/gtsam 1 0%
#10,900 noir 1 0%
#10,901 svt-vp9 1 0%
#10,902 amfora 1 0%
#10,903 denji/nginx/nginx-full --with-brotli-module --with-fancyindex-module --with-http2 --with-realip --with-secure-link --with-vts-module 1 0%
#10,904 ebenoist/protoc-gen-doc/protoc-gen-doc 1 0%
#10,905 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-doom3-icon --with-xwidgets 1 0%
#10,906 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-modern-yellow-icon 1 0%
#10,907 hlrs-vis/tap/openinventor 1 0%
#10,908 hlrs-vis/tap/vsgqt 1 0%
#10,909 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-game-music-emu --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-librsvg --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,910 skyzyx/webp/webp-full 1 0%
#10,911 logstash 1 0%
#10,912 ittybittyapps/appstoreconnect-cli/appstoreconnect-cli --HEAD 1 0%
#10,913 farcloser/mycota/haustorium --HEAD 1 0%
#10,914 haji-ali/emacsmacport/emacs-mac@29 1 0%
#10,915 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,916 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,917 tesslio/tessl/tessl 1 0%
#10,918 apiaryio/formulae/drafter 1 0%
#10,919 buckleypaul/tap/mdglow 1 0%
#10,920 sidneys/homebrew/openssl@1.0 --with-synctex 1 0%
#10,921 gnu-tar --HEAD 1 0%
#10,922 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-whisper-cpp --with-xvid 1 0%
#10,923 graysoncash/soundctl/soundctl 1 0%
#10,924 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-game-music-emu --with-jack --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,925 pongogo/pongogo/pongogo 1 0%
#10,926 xpdf 1 0%
#10,927 tractor/tractor/tractor 1 0%
#10,928 rclone --HEAD 1 0%
#10,929 ataraxy-labs/tap/gh-agent 1 0%
#10,930 latticehq/lattice/lattice 1 0%
#10,931 d12frosted/emacs-plus/emacs-plus@29 --with-modern-pen-3d-icon --with-native-comp 1 0%
#10,932 fastrace 1 0%
#10,933 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-sexy-v2-icon --with-spacemacs-icon --with-xwidgets 1 0%
#10,934 lgarron/lgarron/lstow --HEAD 1 0%
#10,935 samba-rgb/wake/wake 1 0%
#10,936 python@3.12 --HEAD 1 0%
#10,937 usbmuxd --HEAD 1 0%
#10,938 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#10,939 nanocl 1 0%
#10,940 review-goose 1 0%
#10,941 vburojevic/tap/xcbolt 1 0%
#10,942 saviomartin/sqsh/sqsh 1 0%
#10,943 denji/nginx/nginx-full --with-addition --with-auth-req --with-dav-ext-module --with-debug --with-webdav 1 0%
#10,944 macvim-dev/macvim/macvim --HEAD 1 0%
#10,945 tecolicom/tap/app-greple-tee 1 0%
#10,946 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-decklink --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,947 neved4/tap/wafw00f 1 0%
#10,948 s4l1hs/hashsmith/hashsmith 1 0%
#10,949 sip 1 0%
#10,950 yodl 1 0%
#10,951 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#10,952 ahobsonsayers/valve/vapoursynth-ffmpeg --HEAD 1 0%
#10,953 logrotate 1 0%
#10,954 railwaycat/emacsmacport/emacs-mac@30exp --HEAD --with-native-comp --with-starter --with-unlimited-select 1 0%
#10,955 liquidsoul/formulae/l10nconverter 1 0%
#10,956 tuist/tuist/tuist@3.26.0 1 0%
#10,957 hl 1 0%
#10,958 dnglab 1 0%
#10,959 libplctag 1 0%
#10,960 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-mac-metal --with-modern-icon --with-native-compilation --with-starter 1 0%
#10,961 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jack --with-libaribb24 --with-libbluray --with-libflite --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-webp --with-zeromq --with-zimg 1 0%
#10,962 sox_ng 1 0%
#10,963 slack-mcp-server 1 0%
#10,964 issakuss/papnt/papnt 1 0%
#10,965 railwaycat/emacsmacport/emacs-mac@30exp --HEAD --with-glib --with-librsvg --with-native-comp --with-xwidgets 1 0%
#10,966 tn8r/tn8r/tn8r 1 0%
#10,967 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-debug --with-imagemagick 1 0%
#10,968 indilib/indi/indi-nexstarevo 1 0%
#10,969 bazelbuild/tap/bazel@5.4.0 1 0%
#10,970 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-librsvg --with-libsoxr --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-speex --with-webp --with-xvid 1 0%
#10,971 robtaylor/claude-tools/claude-tools 1 0%
#10,972 glib --HEAD --with-fdk-aac --with-jpeg-xl --with-librsvg --with-libsoxr --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-speex --with-two-lame --with-webp --with-zimg 1 0%
#10,973 strand-ai/tap/lambda-cli 1 0%
#10,974 opentelemetry-cpp --HEAD 1 0%
#10,975 mani 1 0%
#10,976 owenjacob/mockery/mockery@2.43.1 1 0%
#10,977 rfidresearchgroup/proxmark3/proxmark3 --with-blueshark --with-flash --with-generic --with-hf-legicsim 1 0%
#10,978 rfidresearchgroup/proxmark3/proxmark3 --with-generic --with-hf-legicsim 1 0%
#10,979 robsalasco/libpostal/libpostal --HEAD 1 0%
#10,980 shivammathur/extensions/ast@8.6 1 0%
#10,981 chenrui333/tap/awless 1 0%
#10,982 bugdea1er/tap/tmp 1 0%
#10,983 abook 1 0%
#10,984 abdousarr/tap/alkali 1 0%
#10,985 sqitchers/sqitch/sqitch --with-postgres-support --with-sqlite-support --with-std-env 1 0%
#10,986 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-librist --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-speex --with-srt --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 1 0%
#10,987 jitinnair1/ssh-import-id/ssh-import-id 1 0%
#10,988 homebrew-ffmpeg/ffmpeg/ffmpeg --with-librist 1 0%
#10,989 arb-project/arb/arb --HEAD --with-debug 1 0%
#10,990 tomekwojcik/tomekwojcik/libosxnotify 1 0%
#10,991 g-dos/easysh/easysh 1 0%
#10,992 ansible-builder 1 0%
#10,993 cyan 1 0%
#10,994 fpng 1 0%
#10,995 cephei8/ols/ols 1 0%
#10,996 satyaborg/blurt/blurt 1 0%
#10,997 goodhatsllc/tap/wlb 1 0%
#10,998 kubefwd 1 0%
#10,999 test 1 0%
#11,000 xc 1 0%
#11,001 d12frosted/emacs-plus/emacs-plus@31 --with-dragon-icon --with-imagemagick --with-xwidgets 1 0%
#11,002 sidaf/pentest/ridenum 1 0%
#11,003 valabind --HEAD 1 0%
#11,004 gnu-apl --HEAD 1 0%
#11,005 d12frosted/emacs-plus/emacs-plus@30 --with-modern-azhilin-icon 1 0%
#11,006 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-unlimited-select 1 0%
#11,007 ublue-os/experimental-tap/bluefin-cli 1 0%
#11,008 d12frosted/emacs-plus/emacs-plus@29 --with-mailutils 1 0%
#11,009 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick 1 0%
#11,010 dlr-ts/sumo/sumo --HEAD --with-swig 1 0%
#11,011 petere/postgresql/postgresql@12 1 0%
#11,012 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-starter --without-modules 1 0%
#11,013 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-doom3-icon 1 0%
#11,014 git-xargs 1 0%
#11,015 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-imagemagick --with-mailutils --with-modern-orange-icon --with-xwidgets 1 0%
#11,016 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-dbus --with-imagemagick --with-native-comp --with-native-full-aot --with-pdumper --with-tree-sitter 1 0%
#11,017 bashate 1 0%
#11,018 kronuz/tap/xapiand 1 0%
#11,019 form 1 0%
#11,020 wtp 1 0%
#11,021 six7chat/six7/six7 1 0%
#11,022 andyjeffries/lazydocs/lazydocs 1 0%
#11,023 filosottile/musl-cross/musl-cross --HEAD 1 0%
#11,024 herbertwxin/citman/citman 1 0%
#11,025 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-sjrmanning-icon --with-starter 1 0%
#11,026 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-big-sur-icon --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-starter 1 0%
#11,027 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libmodplug --with-libopenmpt --with-libplacebo --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,028 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,029 jsonpp 1 0%
#11,030 bandwhich 1 0%
#11,031 dashlane/tap/dashlane-cli --with-corepack 1 0%
#11,032 izhar-karbat/mytap/muscle 1 0%
#11,033 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,034 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-fdk-aac --with-game-music-emu --with-libbluray --with-libopenmpt --with-libsoxr --with-libvmaf --with-rav1e --with-srt --with-svt-av1 --with-tesseract --with-whisper-cpp --with-zimg 1 0%
#11,035 yaduenc/tap/asciicam 1 0%
#11,036 libcoap 1 0%
#11,037 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-xvid 1 0%
#11,038 comby --HEAD 1 0%
#11,039 bazelbuild/tap/bazel@8.4.2 1 0%
#11,040 jmoney8080/teleport/teleport@4.0 1 0%
#11,041 freecad/freecad/fc_bundle_py313_qt6 1 0%
#11,042 kakashysen/ios-simulator-cleaner/ios-simulator-cleaner 1 0%
#11,043 pass-cli 1 0%
#11,044 diagrammo/dgmo/dgmo 1 0%
#11,045 upx --HEAD 1 0%
#11,046 navneetprabhakar/executespec/executespec-cli 1 0%
#11,047 ccsepbvr/pbvr/uwebsockets 1 0%
#11,048 vorbis-tools 1 0%
#11,049 ameshkov/tap/sniproxy 1 0%
#11,050 pdsh 1 0%
#11,051 tuist/tuist/tuist@3.18.0 1 0%
#11,052 dyx884877791/i386-jos-elf-gcc/dev86-jos --HEAD 1 0%
#11,053 gerritforge/gerrit/gerrit@3.12.8 1 0%
#11,054 kronuz/tap/et 1 0%
#11,055 clawparty-ai/clawparty/clawparty 1 0%
#11,056 hevn-inc/tap/hevn-cli 1 0%
#11,057 jonahsnider/tap/spacetimedb 1 0%
#11,058 dbcli/tap/litecli 1 0%
#11,059 d12frosted/emacs-plus/emacs-plus@31 --with-debug --with-mailutils 1 0%
#11,060 dict 1 0%
#11,061 iwen-conf/tap/clash-cleaner 1 0%
#11,062 shivammathur/php/llvm 1 0%
#11,063 noahhhi/tap/horndis 1 0%
#11,064 goldziher/tap/poly 1 0%
#11,065 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libaribb24 --with-libbluray --with-libplacebo --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openjpeg --with-rav1e --with-rubberband --with-speex --with-srt --with-tesseract --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,066 timoni 1 0%
#11,067 pfrederiksen/tap/arccos-api 1 0%
#11,068 tankerhq/repo/ruplacer 1 0%
#11,069 tsonglew/tap/vibe-hero 1 0%
#11,070 libmodbus 1 0%
#11,071 wrapl/rabs/rabs 1 0%
#11,072 clp 1 0%
#11,073 lim 1 0%
#11,074 leaf-proxy 1 0%
#11,075 amberframework/micrate/micrate 1 0%
#11,076 ml-lubich/tap/imsg 1 0%
#11,077 ungive/media-control/media-control 1 0%
#11,078 libxcrypt 1 0%
#11,079 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-libvmaf --with-openh264 --with-openjpeg --with-openvino --with-rtmpdump --with-whisper-cpp 1 0%
#11,080 gromgit/tap/ollama-prompt 1 0%
#11,081 shaisegal/tools/apple-photos-to-immich 1 0%
#11,082 mlaify/tap/attackmap --HEAD 1 0%
#11,083 dahrkai/tap/dahrk 1 0%
#11,084 phpantom-lsp 1 0%
#11,085 seetui 1 0%
#11,086 osdctl 1 0%
#11,087 4-20ma/cryptokit/cryptokit 1 0%
#11,088 chenrui333/tap/archgw 1 0%
#11,089 josefnatanael/i386-elf-toolchain/i386-elf-binutils 1 0%
#11,090 harmonybrew/core/redis@6.2 1 0%
#11,091 asio 1 0%
#11,092 brew-kit/testbrew/testbrew 1 0%
#11,093 shadowsocks-rust 1 0%
#11,094 veracode/tap/gen-ir --HEAD 1 0%
#11,095 jing-trang 1 0%
#11,096 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,097 libopenmpt 1 0%
#11,098 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libssh --with-libvmaf --with-openal-soft --with-openapv --with-openh264 --with-openssl@3 --with-rtmpdump --with-srt --with-two-lame --with-whisper-cpp 1 0%
#11,099 nordstad/pinviz/pinviz 1 0%
#11,100 wossfoss/vapoursynth/vapoursynth-resize2 1 0%
#11,101 shivammathur/extensions/ds@7.4 1 0%
#11,102 filosottile/musl-cross/musl-cross --with-riscv64 --without-aarch64 --without-arm-hf --without-x86_64 1 0%
#11,103 juanheyns/gstack-browse/browse 1 0%
#11,104 bndw/pick/pick-pass 1 0%
#11,105 otel-cli 1 0%
#11,106 snesnopic/tools/flacoutcpp 1 0%
#11,107 shokk/brewster/brewster 1 0%
#11,108 nexus4 1 0%
#11,109 wartremover 1 0%
#11,110 openscad/tap/sparkle --HEAD 1 0%
#11,111 jonasjancarik/tap/codex-autofocus 1 0%
#11,112 producerguy/tap/thermalforge --HEAD 1 0%
#11,113 vhs --HEAD 1 0%
#11,114 router-for-me/core/cliproxyapi --HEAD 1 0%
#11,115 daviderestivo/emacs-head/emacs-head@30 1 0%
#11,116 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,117 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,118 kirankotari/tap/ossguard 1 0%
#11,119 raullenchai/rapid-mlx/rapid-mlx --HEAD 1 0%
#11,120 abakum/tap/crocson 1 0%
#11,121 tommy-mor/thrift/thrift@0.18.1 1 0%
#11,122 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,123 pfrederiksen/tap/ocsfkit 1 0%
#11,124 harmonybrew/core/libid3tag 1 0%
#11,125 jwmossmoz/tap/trybox --HEAD 1 0%
#11,126 barman 1 0%
#11,127 tonymenzo/agentex/agentex 1 0%
#11,128 mikkoparkkola/tap/axterminator 1 0%
#11,129 core-lightning --HEAD 1 0%
#11,130 icy-house/tap/refaver 1 0%
#11,131 kirill-znamenskiy/sandboxed/sandboxed 1 0%
#11,132 kirilkovale1424143/tap/hi 1 0%
#11,133 curieapi/tap/curie 1 0%
#11,134 avvo/avvo/rsh 1 0%
#11,135 kost/ulx3s/nextpnr-trellis --HEAD 1 0%
#11,136 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-libplacebo --with-libvmaf --with-zimg 1 0%
#11,137 sanity 1 0%
#11,138 bigbes/tap/trusttunnel-client --HEAD 1 0%
#11,139 guajardo/tap/peek 1 0%
#11,140 brewsci/science/nusmv 1 0%
#11,141 openhmd 1 0%
#11,142 lizardbyte/homebrew/sunshine --with-cuda --without-static-boost 1 0%
#11,143 love 1 0%
#11,144 aws/tap/_aws-sam-cli-nightly 1 0%
#11,145 nhatvu148/tap/video-transcriber-mcp 1 0%
#11,146 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-jpeg-xl --with-libaribcaption --with-libbluray --with-librist --with-libsoxr --with-libvmaf --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-speex --with-srt --with-two-lame --with-webp --with-xvid --with-zimg 1 0%
#11,147 lz-lunzi/buket/litellm 1 0%
#11,148 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-tesseract --with-zimg 1 0%
#11,149 massimodeluisa/tap/socli 1 0%
#11,150 xcodesorg/made/xcodes --with-mailutils 1 0%
#11,151 seriousben/tiltbar/tiltbar 1 0%
#11,152 richardlehane/digipres/fluxengine 1 0%
#11,153 polypolish 1 0%
#11,154 abhinavsns/openfpm/blitz 1 0%
#11,155 zegervdv/zathura/zathura --with-no-titlebar --with-synctex 1 0%
#11,156 openlore 1 0%
#11,157 d12frosted/emacs-plus/emacs-plus@31 --with-debug 1 0%
#11,158 splguyjr/tap/anhamdie 1 0%
#11,159 elmercsc/elmerfem/elmer --HEAD --with-elmergui --without-hypre 1 0%
#11,160 aliyun-cli --HEAD 1 0%
#11,161 winnowmap 1 0%
#11,162 kreeblah/flashprog-tap/libjaylink 1 0%
#11,163 jolehuit/tap/clother 1 0%
#11,164 brewsci/bio/cyrius 1 0%
#11,165 threatcl 1 0%
#11,166 libressl 1 0%
#11,167 snesnopic/tools/mseedout 1 0%
#11,168 n0mad-ai/tap/bastra-recall 1 0%
#11,169 railwaycat/emacsmacport/emacs-mac@29 --with-glib --with-librsvg 1 0%
#11,170 frotz --HEAD 1 0%
#11,171 xchm 1 0%
#11,172 pzharyuk/tools/live-translator-agent 1 0%
#11,173 posalex/tap/jira-mcp-server 1 0%
#11,174 liviogama/tap/agent-handoff 1 0%
#11,175 feishu2md 1 0%
#11,176 robbiefrancis/cmux-central/cmux-central 1 0%
#11,177 shubham-1994/craft-code/craft-code 1 0%
#11,178 d235j/ios-restore-tools/libgeneral --HEAD 1 0%
#11,179 tgpt 1 0%
#11,180 yelp-xsl 1 0%
#11,181 jadx --HEAD 1 0%
#11,182 kahip/kahip/scc 1 0%
#11,183 hikoyu/shogi/fukauraou 1 0%
#11,184 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-jpeg-xl --with-libxml2 --with-webp --with-zimg 1 0%
#11,185 mhjiang97/tap/mount-manager 1 0%
#11,186 open-tempest-labs/zeashell/zeashell 1 0%
#11,187 eblot/armeabi/arm-none-eabi-gcc 1 0%
#11,188 go-parquet-tools 1 0%
#11,189 recmanj-org/ecmwf/ecbuild 1 0%
#11,190 karlsruhemis/chils/chils 1 0%
#11,191 joeinnes/tap/herd 1 0%
#11,192 microsoft/mssql-release/msodbcsql18@18.6.1.1 1 0%
#11,193 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,194 lqez/npk/npk 1 0%
#11,195 harmonybrew/core/fakechroot 1 0%
#11,196 harmonybrew/core/tree 1 0%
#11,197 cxwx/cxbrew/sofa_c 1 0%
#11,198 probe-rs-tools 1 0%
#11,199 arcadi4/tap/kiro.rs 1 0%
#11,200 cryfs/tap/cryfs 1 0%
#11,201 osrf/simulation/gz-rotary-common --HEAD 1 0%
#11,202 jrieger/tap/gitte 1 0%
#11,203 sergeykolosov/tap/globalprotect-openconnect 1 0%
#11,204 bamtools 1 0%
#11,205 cssr-tools/opm/opm-grid 1 0%
#11,206 attipaci/pub/supernovas --with-cspice 1 0%
#11,207 belingud/tap/gh-download 1 0%
#11,208 spin 1 0%
#11,209 ike-scan --HEAD 1 0%
#11,210 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,211 shivammathur/extensions/v8js@8.5 1 0%
#11,212 vetlewi/formula/qt@5 1 0%
#11,213 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libdovi 1 0%
#11,214 cargo-clone 1 0%
#11,215 cxwx/cxbrew/timr-tui 1 0%
#11,216 z80oolong/vte/geany@9999-dev 1 0%
#11,217 milesbuckton/qemu-virgl/libepoxy-angle 1 0%
#11,218 tiermetric/tap/tierd 1 0%
#11,219 patchutils --HEAD 1 0%
#11,220 pam-u2f 1 0%
#11,221 hexadecimall/kinetic/kinetic 1 0%
#11,222 dyx884877791/i386-jos-elf-gcc/gawk 1 0%
#11,223 akira-toriyama/tap/facet 1 0%
#11,224 alive2 --HEAD 1 0%
#11,225 idleberg/nsisbi/nsisbi@3.03.1 1 0%
#11,226 idleberg/nsisbi/nsisbi@3.02.1.3 1 0%
#11,227 idleberg/nsisbi/nsisbi@3.02.1.1 1 0%
#11,228 idleberg/nsisbi/nsisbi@3.01.2 1 0%
#11,229 starburstdata/jjuicy/jjuicy 1 0%
#11,230 pavelnovichkov/tap/fire 1 0%
#11,231 renode/tap/renode-nightly 1 0%
#11,232 cmarquardt/formulae/r-openmp 1 0%
#11,233 escyezi/tap/deepseek-harness 1 0%
#11,234 ezintz/mariadbdump/mariadbdump@10.11 1 0%
#11,235 a7ex/formulae/findsimulator 1 0%
#11,236 d12frosted/emacs-plus/emacs-plus@30 --with-compress-install --with-imagemagick --with-no-frame-refocus 1 0%
#11,237 d12frosted/emacs-plus/emacs-plus@30 --with-elrumo1-icon 1 0%
#11,238 d12frosted/emacs-plus/emacs-plus@30 --with-nobu417-big-sur-icon --with-xwidgets 1 0%
#11,239 d12frosted/emacs-plus/emacs-plus@30 --with-modern-yellow-icon 1 0%
#11,240 d12frosted/emacs-plus/emacs-plus@30 --with-ctags --with-dbus --with-imagemagick --with-mailutils --with-savchenkovaleriy-big-sur-3d-icon --with-xwidgets 1 0%
#11,241 d12frosted/emacs-plus/emacs-plus@29 --with-savchenkovaleriy-big-sur-icon 1 0%
#11,242 tuist/tuist/tuist@3.23.0 1 0%
#11,243 timharek/tap/yr 1 0%
#11,244 ankitvg/tap/stew 1 0%
#11,245 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --with-modern-sexy-v1-icon --with-modern-sexy-v2-icon --with-xwidgets 1 0%
#11,246 aaratha/emacs-plus/emacs-plus@31 --with-native-comp --with-xwidgets 1 0%
#11,247 netbird 1 0%
#11,248 sundials 1 0%
#11,249 bilix 1 0%
#11,250 freecad/freecad/freecad@1.0.2_py312 1 0%
#11,251 zeromq --HEAD 1 0%
#11,252 cc65 --HEAD 1 0%
#11,253 hlrs-vis/tap/cal3d 1 0%
#11,254 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-skamacs-icon --with-xwidgets 1 0%
#11,255 pillow --HEAD 1 0%
#11,256 waxdred/tap/skyland-cyberdeck 1 0%
#11,257 scrctl/tap/scrctl 1 0%
#11,258 hishamkaram/tap/claude-code-router 1 0%
#11,259 yamale 1 0%
#11,260 jiqiren/tap/cli-toot 1 0%
#11,261 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-speex --with-srt 1 0%
#11,262 harmonybrew/core/cheapglk 1 0%
#11,263 oh-my-reddit 1 0%
#11,264 reglyph/g8n/g8n 1 0%
#11,265 farhad-aman/tap/firelink 1 0%
#11,266 saxena-aman/tap/hoist 1 0%
#11,267 nostoi/why/why-cli 1 0%
#11,268 antlr4-cpp-runtime 1 0%
#11,269 raazketan/tap/claude-session-manager 1 0%
#11,270 serubin/tools/deja-canary --HEAD 1 0%
#11,271 pothosware/pothos/soapybladerf --HEAD 1 0%
#11,272 geraldolsribeiro/tap/microci 1 0%
#11,273 azure-dev --HEAD 1 0%
#11,274 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-starter --with-xwidgets 1 0%
#11,275 opus --HEAD 1 0%
#11,276 homebrew-tools_zip 1 0%
#11,277 jwong1mhs/catalina-legacy/jwong1mhs-kitty 1 0%
#11,278 chopper 1 0%
#11,279 etibarrustam/tap/unison 1 0%
#11,280 nathan-poncet/tap/whisk 1 0%
#11,281 cbusillo/tap/bd-to-avp 1 0%
#11,282 dimpase/tap/sagemath 1 0%
#11,283 macaulay2/tap/topcom 1 0%
#11,284 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-jpeg-xl --with-libaribb24 --with-libplacebo --with-librist --with-librsvg --with-libxml2 --with-openal-soft --with-openh264 --with-openjpeg --with-rav1e 1 0%
#11,285 andreypopp/tap/kido 1 0%
#11,286 open-simh --HEAD 1 0%
#11,287 dadoonet/essentia/essentia 1 0%
#11,288 qca 1 0%
#11,289 yottayoshida/tap/omamori 1 0%
#11,290 gita 1 0%
#11,291 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libaribb24 --with-librist --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-srt --with-webp --with-zimg 1 0%
#11,292 kimi-code 1 0%
#11,293 flyscrape 1 0%
#11,294 evdeepak120202/tap/tidewell 1 0%
#11,295 billy-enrizky/openbrowser/openbrowser-ai 1 0%
#11,296 icu4c@69 1 0%
#11,297 six 1 0%
#11,298 chordii 1 0%
#11,299 neonichu/formulae/cathode 1 0%
#11,300 mas --HEAD 1 0%
#11,301 edgevpn 1 0%
#11,302 facebook/fb/idb-companion --HEAD 1 0%
#11,303 codespell 1 0%
#11,304 nestopia-ue 1 0%
#11,305 sagittarius-scheme 1 0%
#11,306 nsis-dev/makensis/makensis@3.11 1 0%
#11,307 aida0710/tap/sshc 1 0%
#11,308 vi-sql 1 0%
#11,309 siriokds/dual-audio/dual-adplug 1 0%
#11,310 mplayer 1 0%
#11,311 richard-vd/musl-cross/musl-cross --with-mips --without-x86_64 1 0%
#11,312 xenodium/macosrec/macosrec 1 0%
#11,313 feeluown/feeluown/feeluown --with-battery 1 0%
#11,314 sparepartslabs/tap/spareparts-cli 1 0%
#11,315 moosingin3space/tap/gnome-foundry 1 0%
#11,316 yavuzhankursun/tap/aegis 1 0%
#11,317 emosenkis/tap/terminai 1 0%
#11,318 update-nuspec 1 0%
#11,319 spxmiguel/tap/task-manager 1 0%
#11,320 anthonymaley/musictui/musictui 1 0%
#11,321 kube-bench 1 0%
#11,322 vibepod 1 0%
#11,323 samoht/monopam/bottler --HEAD 1 0%
#11,324 hi-artem/boringssl/bssl 1 0%
#11,325 vunnel 1 0%
#11,326 bwa 1 0%
#11,327 ericzhang456/tap/unrar 1 0%
#11,328 pugixml 1 0%
#11,329 c-plusplus-dev/q-tip-uikit/q-tip-uikit --HEAD 1 0%
#11,330 nsis-dev/makensis/makensis@3.03 1 0%
#11,331 harmonybrew/core/sccache 1 0%
#11,332 dynein --HEAD 1 0%
#11,333 air 1 0%
#11,334 nikocreations/fetchx/fetchx 1 0%
#11,335 harmonybrew/core/ooniprobe 1 0%
#11,336 include-what-you-use --HEAD 1 0%
#11,337 libxrandr 1 0%
#11,338 guyghost/tap/swarm-dao 1 0%
#11,339 tpabla/tap/treework 1 0%
#11,340 faudio 1 0%
#11,341 rainfrog 1 0%
#11,342 sbmpost/autoraise/autoraise --with-dexperimental_focus_first 1 0%
#11,343 miles170/emacs/emacs 1 0%
#11,344 cwelsys/tap/sf 1 0%
#11,345 cschlick/tap/greasewood 1 0%
#11,346 yashiels/tap/orro 1 0%
#11,347 keyring 1 0%
#11,348 mrklein/foam/scotch64 1 0%
#11,349 ncview 1 0%
#11,350 avisynthplus 1 0%
#11,351 harmonybrew/core/subnetcalc 1 0%
#11,352 cartr/qt4/freetds --with-universal 1 0%
#11,353 silicon 1 0%
#11,354 aayushgokhale2005/tap/askdocs 1 0%
#11,355 pkgxdev/made/pkgx 1 0%
#11,356 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-jpeg-xl --with-librsvg --with-openh264 --with-openjpeg --with-webp --with-xvid 1 0%
#11,357 polakovic/astronomy/libnova 1 0%
#11,358 tuist/tuist/tuistenv@3.24.0 1 0%
#11,359 cxwx/cxbrew/frizbee 1 0%
#11,360 dannolan/tap/apple-ads-cli 1 0%
#11,361 alpscore 1 0%
#11,362 rpiboot --HEAD 1 0%
#11,363 yncyrydybyl/matrix-commander/matrix-commander-rs 1 0%
#11,364 libxmlsec1 1 0%
#11,365 shivammathur/extensions/zmq@8.6 1 0%
#11,366 shivammathur/extensions/imap@8.6 1 0%
#11,367 caire 1 0%
#11,368 kcat 1 0%
#11,369 brewsci/bio/fasttree 1 0%
#11,370 dcdeniz/aerial/aerial 1 0%
#11,371 railwaycat/emacsmacport/emacs-mac@30exp --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-starter --with-xwidgets --without-modules 1 0%
#11,372 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-imagemagick --with-native-comp --with-native-full-aot --with-pdumper --with-retro-icon-gnu-head --with-tree-sitter --with-xwidgets 1 0%
#11,373 yarden-zamir/tap/chrome-bookmark-rest-controller 1 0%
#11,374 named-data/ndn/ndn-cxx --HEAD 1 0%
#11,375 joeliscoding/tap/astris 1 0%
#11,376 trezor-bridge 1 0%
#11,377 xboard --HEAD 1 0%
#11,378 bandcampdotcom/tap/zookeeper-3.8 1 0%
#11,379 chandansgowda/posture-fix/posture-fix 1 0%
#11,380 schroneko/tap/castkit 1 0%
#11,381 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-modern-icon --with-native-compilation --with-starter 1 0%
#11,382 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-retro-sink-bw 1 0%
#11,383 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-imagemagick --with-librsvg --with-native-compilation --with-retro-sink-bw --with-starter --with-unlimited-select --with-xwidgets 1 0%
#11,384 verilator --HEAD 1 0%
#11,385 harmonybrew/core/lttng-ust 1 0%
#11,386 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,387 try --HEAD 1 0%
#11,388 s9swata/joyboy/joyboy 1 0%
#11,389 io --HEAD 1 0%
#11,390 jpeach/dreamcast/dc-toolchain-testing 1 0%
#11,391 formanator 1 0%
#11,392 tombi --HEAD 1 0%
#11,393 harmonybrew/core/sevenzip 1 0%
#11,394 soapysdr --HEAD 1 0%
#11,395 parthee-vijaya/skynet/skynet 1 0%
#11,396 jahirvidrio/tap/podman-mac-net-connect 1 0%
#11,397 prateek/tap/agentsview 1 0%
#11,398 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name 1 0%
#11,399 sproxy 1 0%
#11,400 sentry-cli 1 0%
#11,401 shivammathur/php/php@8.0-zts 1 0%
#11,402 shivammathur/php/php@8.0-debug-zts 1 0%
#11,403 shivammathur/php/php@8.0-debug 1 0%
#11,404 bufbuild/buf/buf --HEAD 1 0%
#11,405 shivammathur/php/php@7.2-debug 1 0%
#11,406 heathdutton/dogshell/dogshell 1 0%
#11,407 chxbca/rapid-mlx/rapid-mlx 1 0%
#11,408 glbinding@2 1 0%
#11,409 quickjs 1 0%
#11,410 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-modern-icon-emacs-icon4 --with-mps --with-native-comp 1 0%
#11,411 kylef/formulae/conche --HEAD 1 0%
#11,412 anatol/tap/book-reader --HEAD 1 0%
#11,413 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-imagemagick --with-modern-icon-papirus --with-native-comp --with-native-full-aot --with-pdumper --with-tree-sitter --with-xwidgets 1 0%
#11,414 rossburton/ross/auroras 1 0%
#11,415 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libaribcaption --with-libplacebo --with-librist --with-libsoxr --with-libxml2 --with-webp --with-zimg 1 0%
#11,416 startergo/virglrenderer/virglrenderer --HEAD 1 0%
#11,417 temelgunaydin/tap/todo 1 0%
#11,418 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jack --with-jpeg-xl --with-libflite --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 1 0%
#11,419 bobmatnyc/claude-mpm/claude-mpm 1 0%
#11,420 gdl 1 0%
#11,421 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-fdk-aac --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openh264 --with-openjpeg --with-rtmpdump --with-speex --with-srt --with-tesseract --with-webp --with-whisper-cpp --with-zeromq --with-zimg 1 0%
#11,422 rtulke/sshscan/sshscan 1 0%
#11,423 alpha-baby/tap/g 1 0%
#11,424 my-devices/tap/macchina-remote-tools 1 0%
#11,425 dpetersen/tap/krang 1 0%
#11,426 jfasoc/tap/git-tools 1 0%
#11,427 python@3.14 --HEAD 1 0%
#11,428 damsleth/tap/owa-piggy --HEAD 1 0%
#11,429 syslog-ng --HEAD 1 0%
#11,430 libsigsegv 1 0%
#11,431 gm5dna/amateur-radio/qttermtcp 1 0%
#11,432 rvigo/cl/cl 1 0%
#11,433 brewsci/science/bam-readcount 1 0%
#11,434 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-mailutils --with-modern-nuvola-icon --with-xwidgets 1 0%
#11,435 brewsci/science/openni 1 0%
#11,436 srt --HEAD 1 0%
#11,437 dynet 1 0%
#11,438 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-librist --with-librsvg --with-libssh --with-libvidstab --with-libxml2 --with-libzvbi --with-openal-soft --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-xvid 1 0%
#11,439 sigstore 1 0%
#11,440 adwaita-icon-theme 1 0%
#11,441 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq 1 0%
#11,442 freeimage 1 0%
#11,443 jaewoook/nal/rust 1 0%
#11,444 pypy3.12 1 0%
#11,445 gittuf 1 0%
#11,446 jma24/bootsmith/bootsmith 1 0%
#11,447 terramate 1 0%
#11,448 ivoronin/ivoronin/helix-steel 1 0%
#11,449 mkdocs-material 1 0%
#11,450 rosshhun/tap/graphy 1 0%
#11,451 btrfs-progs 1 0%
#11,452 mariadb@12.3 1 0%
#11,453 feh 1 0%
#11,454 typos-lsp 1 0%
#11,455 uchardet 1 0%
#11,456 harmonybrew/core/unbound 1 0%
#11,457 lawrencecurtis/local-vmaf/ffmpeg-full 1 0%
#11,458 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-mac-metal --with-native-compilation --without-modules 1 0%
#11,459 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-native-compilation --without-modules 1 0%
#11,460 c-plusplus-dev/q-tip/q-tip --HEAD 1 0%
#11,461 joeinnes/tap/cow-herd 1 0%
#11,462 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-game-music-emu --with-jpeg-xl --with-libaribcaption --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rubberband --with-srt --with-two-lame --with-webp --with-xvid --with-zimg 1 0%
#11,463 truncateddinosour/dino-bar/arigram 1 0%
#11,464 mzwnet/tap/rlottie 1 0%
#11,465 cobra-cli 1 0%
#11,466 strongswan --HEAD 1 0%
#11,467 scriptscat/tap/sctl 1 0%
#11,468 moonfruit/tap/imsg 1 0%
#11,469 calebcauthon/riff/riff 1 0%
#11,470 valet-sh/core/vsh-php82 1 0%
#11,471 makeworld-the-better-one/tap/didder 1 0%
#11,472 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-ggml --with-jpeg-xl --with-librsvg --with-libsoxr --with-libvidstab --with-libzvbi --with-rav1e --with-rubberband --with-tensorflow --with-tesseract --with-webp --with-whisper-cpp --with-xvid 1 0%
#11,473 harmonybrew/core/postgresql@18 1 0%
#11,474 wx-cli 1 0%
#11,475 d12frosted/emacs-plus/emacs-plus@32 --with-compress-install --with-dbus --with-mailutils --with-xwidgets 1 0%
#11,476 sinew-mocap/sinew/sinew-vr-bridge 1 0%
#11,477 cpm 1 0%
#11,478 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jack --with-libaribcaption --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,479 jaewoook/nal/node 1 0%
#11,480 das-developers/das/das2c 1 0%
#11,481 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,482 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libbluray --with-libgsm --with-libmodplug --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-rubberband --with-speex --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,483 somo 1 0%
#11,484 qqqa 1 0%
#11,485 fx-agent 1 0%
#11,486 acture/ac/docpack 1 0%
#11,487 xkeyboard-config 1 0%
#11,488 findomain 1 0%
#11,489 tinyframe 1 0%
#11,490 ast-grep --HEAD 1 0%
#11,491 languagetool-rust 1 0%
#11,492 rolbk/tap/worktimeutil 1 0%
#11,493 znc 1 0%
#11,494 zurl 1 0%
#11,495 prr 1 0%
#11,496 sslsplit 1 0%
#11,497 memtier_benchmark 1 0%
#11,498 libksba 1 0%
#11,499 cagent 1 0%
#11,500 uidops/brewops/bicon 1 0%
#11,501 johntharian/hyperthymesia/hyperthymesia 1 0%
#11,502 brewsci/bio/antismash 1 0%
#11,503 gptline 1 0%
#11,504 icu4c@77.1 1 0%
#11,505 khan/repo/python@2 1 0%
#11,506 celero 1 0%
#11,507 networkit 1 0%
#11,508 libvdpau 1 0%
#11,509 pioneer --HEAD 1 0%
#11,510 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,511 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-crash-debug --with-imagemagick --with-mailutils --with-modern-icon-nuvola --with-native-comp --with-tree-sitter --with-xwidgets --without-libxml2 1 0%
#11,512 kanata-tray 1 0%
#11,513 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-imagemagick --with-modern-icon-bokehlicia-captiva --with-mps --with-native-comp --with-native-full-aot --with-tree-sitter 1 0%
#11,514 spatialite-gui 1 0%
#11,515 brewsci/bio/libsequence 1 0%
#11,516 debugee/mytap/mytool 1 0%
#11,517 willyv3/tap/cattui 1 0%
#11,518 imgproxy 1 0%
#11,519 gor 1 0%
#11,520 brewsci/science/lie 1 0%
#11,521 brewsci/science/fastml 1 0%
#11,522 brewsci/science/colpack 1 0%
#11,523 brewsci/bio/tigmint 1 0%
#11,524 ffmpegthumbnailer 1 0%
#11,525 ltex-ls 1 0%
#11,526 s4cmd 1 0%
#11,527 neprel/tap/git-a2a 1 0%
#11,528 harmonybrew/core/fnm 1 0%
#11,529 squashfs --HEAD 1 0%
#11,530 startergo/qemu-virgl/gn 1 0%
#11,531 bgrep 1 0%
#11,532 cpulimit 1 0%
#11,533 cbmbasic 1 0%
#11,534 jarl 1 0%
#11,535 cloudboy-jh/tap/coffee --HEAD 1 0%
#11,536 mehmetvarol/katip/katip --HEAD 1 0%
#11,537 goranb131/ithas-prismafs/prismafs 1 0%
#11,538 marlonjames71/tap/ow 1 0%
#11,539 rfidresearchgroup/proxmark3/proxmark3 --HEAD --without-qt@5 1 0%
#11,540 takeonepiece/tap/vibe-tabs 1 0%
#11,541 yuangunn/tap/image-trigger-clicker 1 0%
#11,542 xmrig --HEAD 1 0%
#11,543 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,544 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,545 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,546 openmsx 1 0%
#11,547 libdave 1 0%
#11,548 gmssl 1 0%
#11,549 harmonybrew/core/ggshield 1 0%
#11,550 rsds143/sperf/sperf 1 0%
#11,551 buckleypaul/mdsee/mdsee 1 0%
#11,552 osx-cpu-temp 1 0%
#11,553 moor 1 0%
#11,554 peachlifeab/tap/sive 1 0%
#11,555 beagle-imputation 1 0%
#11,556 adrianov/rhino-player/rhino-player 1 0%
#11,557 rafi/tap/gits --HEAD 1 0%
#11,558 brewsci/science/tagdust 1 0%
#11,559 brewsci/science/sllib 1 0%
#11,560 brewsci/science/slicot 1 0%
#11,561 brewsci/science/skewer 1 0%
#11,562 brewsci/science/scarpa 1 0%
#11,563 brewsci/science/littler 1 0%
#11,564 datris/tap/datris 1 0%
#11,565 offbeatengineer/tap/vocal 1 0%
#11,566 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-dbus --with-debug --without-cocoa 1 0%
#11,567 brewsci/science/geant4 1 0%
#11,568 rioriost/tap/trmd 1 0%
#11,569 weave 1 0%
#11,570 broberson/taps/bfgminer 1 0%
#11,571 garden 1 0%
#11,572 kahip/kahip/red2pack 1 0%
#11,573 taclane/sdr/dumpvdl2 1 0%
#11,574 taclane/sdr/vdlm2dec --with-airspy 1 0%
#11,575 adamzafir/lgtv-cli/lgtv-cli 1 0%
#11,576 dgarnier/plasma/mdsplus --HEAD 1 0%
#11,577 scasella/tap/tabpilot 1 0%
#11,578 k0iry/i386-jos-toolchains/i386-jos-elf-binutils 1 0%
#11,579 git-workspace 1 0%
#11,580 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,581 movableink/formulas/qtwebkit 1 0%
#11,582 chainsaw 1 0%
#11,583 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,584 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-emacs-sexy-icon --with-librsvg --with-native-compilation --with-starter 1 0%
#11,585 shivammathur/extensions/gnupg@8.6 1 0%
#11,586 shivammathur/extensions/uploadprogress@8.6 1 0%
#11,587 proxy-ns --HEAD 1 0%
#11,588 p11-kit --with-fdk-aac 1 0%
#11,589 kleidicode/sasho/sasho 1 0%
#11,590 iproute2 1 0%
#11,591 blueman 1 0%
#11,592 taclane/sdr/iridium-sniffer --HEAD 1 0%
#11,593 bear10591/tap/asset-tools --HEAD 1 0%
#11,594 thamwangjun/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-libbluray --with-librsvg --with-libsoxr --with-libxml2 --with-openjpeg --with-openssl --with-rav1e --with-srt --with-svt-av1 --with-tesseract --with-webp 1 0%
#11,595 michaelmjhhhh/vibe-shot/vibe-shot 1 0%
#11,596 shivammathur/extensions/decimal@7.0 1 0%
#11,597 rshelekhov/tap/lazymake 1 0%
#11,598 psytron/blobx/blobx 1 0%
#11,599 the_silver_searcher --HEAD 1 0%
#11,600 powerlevel10k --HEAD 1 0%
#11,601 readsb 1 0%
#11,602 oath-toolkit 1 0%
#11,603 harmonybrew/core/libpng 1 0%
#11,604 lookinside 1 0%
#11,605 octoenergy/tap/kraken-cli --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-jpeg-xl --with-libbluray --with-libbs2b --with-libdvdnav --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,606 david-icracked/idevicerestore/idevicerestore --HEAD 1 0%
#11,607 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-gcc --with-hypre --with-openmp --without-mumps 1 0%
#11,608 vulkan-utility-libraries --HEAD 1 0%
#11,609 mc-rtc/mc-rtc/spacevecalg 1 0%
#11,610 portsmf --HEAD 1 0%
#11,611 railwaycat/emacsmacport/emacs-mac@29 --with-native-compilation --with-starter --with-unlimited-select 1 0%
#11,612 openapi-tui 1 0%
#11,613 ronn 1 0%
#11,614 boot-to-talos 1 0%
#11,615 d12frosted/emacs-plus/emacs-plus@30 --with-modern-sexy-v1-icon 1 0%
#11,616 d12frosted/emacs-plus/emacs-plus@29 --with-cacodemon-icon --with-native-comp 1 0%
#11,617 dennis97519/lc3tools/complx --HEAD 1 0%
#11,618 d12frosted/emacs-plus/emacs-plus@31 --with-modern-papirus-icon 1 0%
#11,619 d12frosted/emacs-plus/emacs-plus@30 --with-elrumo2-icon --with-imagemagick --with-modern-alecive-flatwoken-icon 1 0%
#11,620 aaratha/emacs-plus/emacs-plus@31 --with-native-comp --with-x11 1 0%
#11,621 rtl_433 --HEAD 1 0%
#11,622 d12frosted/emacs-plus/emacs-plus@29 --with-savchenkovaleriy-big-sur-3d-icon 1 0%
#11,623 nhurd/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-modern-icon --with-optimization-flags --with-starter --with-transparent-titlebar 1 0%
#11,624 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-native-comp --with-starter 1 0%
#11,625 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-librsvg --with-native-compilation 1 0%
#11,626 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-big-sur-icon --with-imagemagick --with-native-compilation --with-xwidgets 1 0%
#11,627 mlt --HEAD 1 0%
#11,628 namest504/termtype/termtype 1 0%
#11,629 dguest/biber/biber@2.17 1 0%
#11,630 zunit-zsh/zunit/zunit 1 0%
#11,631 gojq 1 0%
#11,632 spry 1 0%
#11,633 forgeekscn/clean-mac/clean-mac 1 0%
#11,634 freecad/freecad/boost-python3.11 1 0%
#11,635 kris-hansen/comanda/comanda 1 0%
#11,636 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-svt-av1 1 0%
#11,637 mheryerznkanyan/testocracy/ios-test-automator 1 0%
#11,638 gromgit/dev/vlang-weekly 1 0%
#11,639 bazelbuild/tap/bazel@8.3.0 1 0%
#11,640 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,641 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,642 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,643 timmyovo/tracy/tracy 1 0%
#11,644 soplex 1 0%
#11,645 nihilok/tap/runtool 1 0%
#11,646 kubesess 1 0%
#11,647 rhajizada/tap/cradle 1 0%
#11,648 prips 1 0%
#11,649 muzimuzhi/beta/pkl-vscode 1 0%
#11,650 lgarron/lgarron/thirdparty-oavif 1 0%
#11,651 pioneer 1 0%
#11,652 arustydev/tap/euporie 1 0%
#11,653 osx-cross/avr/avr-gcc@10 1 0%
#11,654 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,655 dorky-robot/katulong/katulong 1 0%
#11,656 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-flash --with-generic --with-smartcard 1 0%
#11,657 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-rubberband --with-speex --with-srt --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,658 wish/wish/wish-ctl 1 0%
#11,659 libsamplerate 1 0%
#11,660 instalooter 1 0%
#11,661 shaypal5/tap/foldermix 1 0%
#11,662 pacparser 1 0%
#11,663 jmoney8080/teleport/teleport@3.1 1 0%
#11,664 xcodesorg/made/xcodes --with-odbc 1 0%
#11,665 mht208/formal/lean 1 0%
#11,666 erikkinding/tap/sk 1 0%
#11,667 redict 1 0%
#11,668 bwilczynski/tap/sonos-cli 1 0%
#11,669 x-cli 1 0%
#11,670 railwaycat/emacsmacport/emacs-mac@29 --with-mac-metal --with-native-compilation --with-no-title-bars --with-spacemacs-icon --with-starter --with-unlimited-select --with-xwidgets 1 0%
#11,671 osrf/simulation/gz-msgs11 1 0%
#11,672 koekeishiya/formulae/yabai --HEAD 1 0%
#11,673 d12frosted/emacs-plus/emacs-plus@30 --HEAD --with-compress-install --with-imagemagick 1 0%
#11,674 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-libaribb24 --with-libaribcaption --with-libplacebo --with-librist --with-libsoxr --with-libxml2 --with-webp --with-zimg 1 0%
#11,675 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libflite --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 1 0%
#11,676 mac-cleanup-py --HEAD 1 0%
#11,677 chibokocl/tap/medgemma 1 0%
#11,678 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-imagemagick --with-mailutils --with-native-comp --with-native-full-aot --with-tree-sitter --with-xwidgets 1 0%
#11,679 atoerien/tap/java-debug 1 0%
#11,680 neved4/tap/tailsocks 1 0%
#11,681 gh-ost --HEAD 1 0%
#11,682 codec2 1 0%
#11,683 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-jpeg-xl --with-librsvg --with-libsoxr --with-libxml2 --with-opencore-amr --with-openh264 --with-openjpeg --with-speex --with-two-lame --with-webp --with-zimg 1 0%
#11,684 nxtedition/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-libplacebo --with-svt-av1 --with-webp 1 0%
#11,685 d12frosted/emacs-plus/emacs-plus@29 --with-cacodemon-icon --with-native-comp --with-no-frame-refocus 1 0%
#11,686 dbt-labs/dbt/dbt@0.10.0 1 0%
#11,687 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-librist --with-librsvg --with-libssh --with-libvidstab --with-libxml2 --with-libzvbi --with-openal-soft --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid 1 0%
#11,688 wgo 1 0%
#11,689 wcarhart/tools/smoosh 1 0%
#11,690 halbotley/tap/timely --HEAD 1 0%
#11,691 halbotley/tap/calmly --HEAD 1 0%
#11,692 bohica-labs/writescore/writescore 1 0%
#11,693 actuallytaylor/formulae/cereal-console 1 0%
#11,694 php@8.0 1 0%
#11,695 shivammathur/extensions/ds@8.5 1 0%
#11,696 shivammathur/extensions/decimal@7.4 1 0%
#11,697 xperiential 1 0%
#11,698 shivammathur/extensions/phpredis@8.1 1 0%
#11,699 cozycactus/tap/soapyrx888 --HEAD 1 0%
#11,700 telemt 1 0%
#11,701 tinysparql 1 0%
#11,702 globstar 1 0%
#11,703 tocheskey/idevice/libfragmentzip 1 0%
#11,704 brewsci/science/hyphy 1 0%
#11,705 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-ctags --with-dbus --with-emacs-sexy-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-no-title-bars --with-starter --with-unlimited-select --with-xwidgets 1 0%
#11,706 junelegency/claude-history-search/claude-history-search 1 0%
#11,707 flang --HEAD 1 0%
#11,708 shivammathur/extensions/v8js@8.2 1 0%
#11,709 shivammathur/extensions/protobuf@8.6 1 0%
#11,710 libpipewire 1 0%
#11,711 snelusha/noto/noto 1 0%
#11,712 d12frosted/emacs-plus/emacs-plus@31 --with-mps --with-xwidgets 1 0%
#11,713 livekit-cli --HEAD 1 0%
#11,714 shopify/shopify/shopify-libgraphqlparser 1 0%
#11,715 mpd --HEAD 1 0%
#11,716 gm5dna/amateur-radio/samoyed --HEAD 1 0%
#11,717 avro-c 1 0%
#11,718 railwaycat/emacsmacport/emacs-mac@29 --with-native-comp --with-no-title-bars 1 0%
#11,719 harmonybrew/core/openssl@3.0 1 0%
#11,720 snapcraft 1 0%
#11,721 lawmurray/all/doxide 1 0%
#11,722 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-mps --with-native-full-aot --with-tree-sitter 1 0%
#11,723 laixintao/tap/mouse-speed-keeper 1 0%
#11,724 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,725 bagels 1 0%
#11,726 tt 1 0%
#11,727 allegro --HEAD 1 0%
#11,728 fraluc06/tap/lazymake 1 0%
#11,729 tamentis/core/mdp 1 0%
#11,730 iitdbgroup/iitdbgroup/gprom --with-instantclient-sdk --with-monetdb 1 0%
#11,731 nitinbhat972/cwal/cwal 1 0%
#11,732 fbthrift --HEAD 1 0%
#11,733 brunvonlope/core-fix/libheif-plugin-j2k 1 0%
#11,734 andrzejchm/notion-cli/notion-cli 1 0%
#11,735 matthewyang204/formulae-casks/custom-clear 1 0%
#11,736 polidisio/exiftool-cli/exiftool-cli --HEAD 1 0%
#11,737 inspectrum 1 0%
#11,738 sujay2306/aws-iam-agent/aws-iam-agent 1 0%
#11,739 agiletec-inc/tap/airis-menubar 1 0%
#11,740 skeptomai/gruesome/gruesome 1 0%
#11,741 cpp-lazy 1 0%
#11,742 spmdestinations/tap/spm-dest-5.3-x86_64-amazonlinux2 1 0%
#11,743 d12frosted/emacs-plus/emacs-plus@29 --with-modern-yellow-icon 1 0%
#11,744 pehlicd/tap/amtui 1 0%
#11,745 opus-tools --HEAD 1 0%
#11,746 ashaltu/tap/qvm@0.2.1 1 0%
#11,747 railwaycat/emacsmacport/emacs-mac@29 --with-ctags --with-glib --with-imagemagick --with-librsvg --with-modern-icon --with-native-compilation --with-natural-title-bar --with-starter --with-unlimited-select 1 0%
#11,748 d12frosted/emacs-plus/emacs-plus@29 --with-imagemagick --with-modern-doom3-icon 1 0%
#11,749 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jack --with-webp 1 0%
#11,750 marceljj/tap/gnome-lorem 1 0%
#11,751 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-native-comp --with-no-title-bars --with-starter 1 0%
#11,752 ensembl/external/cd-hit 1 0%
#11,753 devaloi/tap/qwiqen --HEAD 1 0%
#11,754 nedap/versions/gettext@0.23.1 1 0%
#11,755 polynote 1 0%
#11,756 lizardbyte/homebrew/sunshine --with-static-boost 1 0%
#11,757 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-mac-metal 1 0%
#11,758 peiyuanwang0/unify/unify 1 0%
#11,759 graygnuorg/tap/pound 1 0%
#11,760 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread 1 0%
#11,761 lescanauxdiscrets/tap/ffmpeg --with-fdk-aac --with-librsvg --with-libsoxr --with-libvidstab --with-libvmaf --with-libzvbi --with-rtmpdump --with-srt --with-tesseract --with-webp 1 0%
#11,762 nuspell 1 0%
#11,763 filosottile/musl-cross/musl-cross --with-arm-hf --without-aarch64 1 0%
#11,764 dnscrypt-proxy --HEAD 1 0%
#11,765 minimal-racket 1 0%
#11,766 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,767 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-gnu-head-icon --with-imagemagick --with-mac-metal --with-starter 1 0%
#11,768 neved4/tap/wmiexec-pro 1 0%
#11,769 denji/nginx/nginx-full --with-debug --with-flv --with-http2 --with-image-filter --with-mp4 --with-rtmp-module --with-slice --with-stream --with-stream-ssl --with-upload-module 1 0%
#11,770 fisaogullari/macbinbundler/macbinbundler --HEAD 1 0%
#11,771 prql/prql/prqlc 1 0%
#11,772 schollz/tap/e2ecp 1 0%
#11,773 choufeng/qk/qk 1 0%
#11,774 railwaycat/emacsmacport/emacs-mac@29 --with-imagemagick --with-spacemacs-icon 1 0%
#11,775 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-modern-doom-icon 1 0%
#11,776 regenrek/tap/peakypanes 1 0%
#11,777 rift 1 0%
#11,778 hayagriva 1 0%
#11,779 regipy 1 0%
#11,780 cehoffman/personal/stderred --HEAD 1 0%
#11,781 k1low/tap/tbls 1 0%
#11,782 chuck 1 0%
#11,783 denji/nginx/nginx-full --with-auth-pam-module --with-auth-req --with-mp4 --with-mp4-h264-module --with-rtmp-module --with-stream --with-upload-module --with-vod-module --with-webdav 1 0%
#11,784 michael-amiethyst/core/bashpile 1 0%
#11,785 libxaw3d 1 0%
#11,786 sabirdzh/tap/studylib 1 0%
#11,787 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-openh264 --with-xvid 1 0%
#11,788 d12frosted/emacs-plus/emacs-plus@31 --with-no-frame-refocus 1 0%
#11,789 openjdk@17 --HEAD 1 0%
#11,790 matchylabs/matchy/jq-matchy 1 0%
#11,791 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-emacs-big-sur-icon --with-mac-metal --with-native-compilation --with-natural-title-bar --with-starter --without-tree-sitter 1 0%
#11,792 gromgit/fuse/fuse-zip-mac 1 0%
#11,793 gromgit/fuse/cryfs-mac 1 0%
#11,794 swordfaith/pentest/wafw00f 1 0%
#11,795 stek29/idevice/libideviceactivation --HEAD 1 0%
#11,796 ibrewster/avo/volcano-ash3d-metreader 1 0%
#11,797 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-librist --with-srt --with-zeromq 1 0%
#11,798 cupertino 1 0%
#11,799 neovim-remote 1 0%
#11,800 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libvmaf --with-rav1e --with-svt-av1 1 0%
#11,801 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-fdk-aac --with-jpeg-xl --with-openjpeg --with-svt-av1 --with-webp 1 0%
#11,802 murtaza-s/tap/teletypy 1 0%
#11,803 airspyhf 1 0%
#11,804 d12frosted/emacs-plus/emacs-plus@29 --with-ctags --with-imagemagick --with-modern-sexy-v2-icon --with-xwidgets 1 0%
#11,805 rdp/openssh-gssapi/openssh-patched --with-gssapi-support --with-hpn --with-keychain-support 1 0%
#11,806 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-ctags --with-imagemagick --with-pdumper --with-tree-sitter --with-xwidgets 1 0%
#11,807 hybras/tap/abaddon --HEAD 1 0%
#11,808 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-sexy-icon --with-imagemagick --with-librsvg --with-native-comp --with-starter --with-xwidgets 1 0%
#11,809 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-ctags --with-dbus --with-emacs-big-sur-icon --with-glib --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-natural-title-bar --with-starter --with-xwidgets 1 0%
#11,810 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-librsvg --with-native-comp --with-xwidgets 1 0%
#11,811 cairo@1.8.10 1 0%
#11,812 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-libaribb24 --with-libaribcaption --with-srt 1 0%
#11,813 anthrotype/ttfautohint/ttfautohintgui --HEAD 1 0%
#11,814 pngquant 1 0%
#11,815 colindean/personal/jqfmt --HEAD 1 0%
#11,816 gromgit/dev/graphqlite 1 0%
#11,817 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-dbus --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-starter --with-xwidgets 1 0%
#11,818 sidaf/pentest/simply_email 1 0%
#11,819 sidaf/pentest/windows-exploit-suggester 1 0%
#11,820 feroxbuster 1 0%
#11,821 d12frosted/emacs-plus/emacs-plus@30 --with-imagemagick --without-cocoa 1 0%
#11,822 d12frosted/emacs-plus/emacs-plus@30 --with-mailutils --with-modern-sexy-v1-icon --with-no-frame-refocus 1 0%
#11,823 libdvdread 1 0%
#11,824 ampcode/tap/ampcode 1 0%
#11,825 mhriemers/tools/overseerr 1 0%
#11,826 zigmars/taps/ext4fuse 1 0%
#11,827 qtcharts --HEAD 1 0%
#11,828 cassandra-cpp-driver 1 0%
#11,829 shivammathur/extensions/rdkafka@8.6 1 0%
#11,830 qt5compat --HEAD 1 0%
#11,831 brush --HEAD 1 0%
#11,832 odnoletkov/formulae/urlcomponents 1 0%
#11,833 tarkahq/tap/tarka 1 0%
#11,834 chrihop/gcc_cross_compilers/i386-elf-binutils 1 0%
#11,835 gobject-introspection --with-fdk-aac 1 0%
#11,836 8op-org/tap/glitch-dev --HEAD 1 0%
#11,837 arf 1 0%
#11,838 dunamai 1 0%
#11,839 mhash 1 0%
#11,840 loki 1 0%
#11,841 starship --HEAD 1 0%
#11,842 zerobox 1 0%
#11,843 securefs 1 0%
#11,844 rvvm 1 0%
#11,845 wickles/tap/repology 1 0%
#11,846 jsongrep 1 0%
#11,847 harmonybrew/core/binutils 1 0%
#11,848 sozua-ciandt/tap/kill-the-bill 1 0%
#11,849 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-ggml --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,850 simnalamburt/x/totp 1 0%
#11,851 thrift@0.9 1 0%
#11,852 zigrivers/surface/surface 1 0%
#11,853 williamcotton/algraf/algraf 1 0%
#11,854 rapastranac/gempba/gempba 1 0%
#11,855 harmonybrew/core/rsync 1 0%
#11,856 lisette 1 0%
#11,857 virtuoso 1 0%
#11,858 robdel12/fruitbat/fruitbat --HEAD 1 0%
#11,859 qtgrpc --HEAD 1 0%
#11,860 qtgraphs --HEAD 1 0%
#11,861 hurricos/postgresql/postgresql@14 1 0%
#11,862 google-benchmark 1 0%
#11,863 respawn-app/tap/builder-cli 1 0%
#11,864 cxwx/cxbrew/clad 1 0%
#11,865 chen1plus/tongwen/quill 1 0%
#11,866 andresv/gnuradio/gr-osmosdr --HEAD 1 0%
#11,867 getdns 1 0%
#11,868 harmonybrew/core/git 1 0%
#11,869 inchi 1 0%
#11,870 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,871 salehalbuga/formulae/swift-func 1 0%
#11,872 sur950/geekcode/geekcode --HEAD 1 0%
#11,873 mosra/magnum/magnum-plugins --HEAD 1 0%
#11,874 tea --HEAD 1 0%
#11,875 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-jpeg-xl --with-rav1e 1 0%
#11,876 d12frosted/emacs-plus/emacs-plus@30 --with-dbus --with-debug --with-imagemagick --with-mailutils 1 0%
#11,877 lukaspustina/os/nmap-analyze 1 0%
#11,878 pthariensflame/assorted/vulkansc-pcutil --HEAD 1 0%
#11,879 riscv32-ilp32-gcc 1 0%
#11,880 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-librsvg --with-openal-soft --with-rav1e --with-srt --with-svt-av1 --with-webp --with-xvid --with-zimg 1 0%
#11,881 danielbair/tap/lxml 1 0%
#11,882 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#11,883 hasdfa/linctl/linctl 1 0%
#11,884 litra 1 0%
#11,885 docbook 1 0%
#11,886 atani/tap/glowm 1 0%
#11,887 xavdid/projects/potent 1 0%
#11,888 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-native-compilation --with-starter --without-modules 1 0%
#11,889 lynkr 1 0%
#11,890 steigr/taps/setup-formula 1 0%
#11,891 platformio --HEAD 1 0%
#11,892 junlinwk/e3cli/e3cli 1 0%
#11,893 denji/nginx/nginx-full --with-vod-module 1 0%
#11,894 gulp-cli 1 0%
#11,895 railwaycat/emacsmacport/emacs-mac@31exp --HEAD --with-native-comp 1 0%
#11,896 highs 1 0%
#11,897 broberson/taps/curl@7.88.1 1 0%
#11,898 buacanning/anin/anin 1 0%
#11,899 homeassistant-cli --HEAD 1 0%
#11,900 excelsior2026/ese/ese-cli 1 0%
#11,901 oozoofrog/swiftnest/swiftnest 1 0%
#11,902 stek29/idevice/fsmon 1 0%
#11,903 lld@21 1 0%
#11,904 talhamsajid/tap/axon-pro 1 0%
#11,905 sd 1 0%
#11,906 riscv-software-src/riscv/riscv-openocd --HEAD 1 0%
#11,907 tschoonj/tap/xmi-msim 1 0%
#11,908 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-libaribb24 --with-libvmaf 1 0%
#11,909 ccm 1 0%
#11,910 kalijason/tools/mac-tts 1 0%
#11,911 sidaf/pentest/odat 1 0%
#11,912 joshuachp/tap/note 1 0%
#11,913 unitycatalog 1 0%
#11,914 haproxy@2.8 1 0%
#11,915 gloox 1 0%
#11,916 precious 1 0%
#11,917 extract_url 1 0%
#11,918 emicklei/tap/melrose 1 0%
#11,919 clusterctl 1 0%
#11,920 harmonybrew/core/mycli 1 0%
#11,921 xsreality/tap/claude-deja-vu 1 0%
#11,922 jrmastermodelbuilder/flasm/flasm 1 0%
#11,923 veto 1 0%
#11,924 ctxme/cli/ctxme 1 0%
#11,925 stargrid-systems/tap/simavr 1 0%
#11,926 hogelog/tap/mdv 1 0%
#11,927 pngpaste 1 0%
#11,928 vikabelnitska/chronify/chronify 1 0%
#11,929 openresty/brew/openresty --HEAD 1 0%
#11,930 zm2231/tap/agenthail 1 0%
#11,931 gcc@10 1 0%
#11,932 nvk/tap/envchain-xtra 1 0%
#11,933 tmonk/brew/tectdist 1 0%
#11,934 seanchatmangpt/ggen/ggen 1 0%
#11,935 trinverse/cortex/cortex-fm 1 0%
#11,936 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libbluray --with-libflite --with-libplacebo --with-librsvg --with-openal-soft --with-openapv --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-svt-av1 --with-tensorflow --with-tesseract --with-webp --with-whisper-cpp --with-xvid 1 0%
#11,937 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-dvd 1 0%
#11,938 lbfgspp 1 0%
#11,939 pkryger/emacsmacport-exp/emacs-mac-exp@30 --HEAD --with-arc --with-ctags --with-mac-metal --with-optimization-flags --with-transparent-titlebar --with-unlimited-select --with-xwidgets 1 0%
#11,940 d12frosted/emacs-plus/emacs-plus@31 --with-retro-sink-bw-icon 1 0%
#11,941 libedit 1 0%
#11,942 anderssteennilsen/zshgpt/zshgpt 1 0%
#11,943 vifm --HEAD 1 0%
#11,944 sniffnet 1 0%
#11,945 cotp 1 0%
#11,946 vitroid/yaplot/yaplot 1 0%
#11,947 burp 1 0%
#11,948 ascelerate 1 0%
#11,949 python-freethreading 1 0%
#11,950 harmonybrew/core/tippecanoe 1 0%
#11,951 userspace-rcu 1 0%
#11,952 railwaycat/emacsmacport/emacs-mac@31exp --with-librsvg --with-native-compilation 1 0%
#11,953 respawn-llc/tap/ksrc 1 0%
#11,954 zbeekman/tap/flang-headers 1 0%
#11,955 newrelic-cli 1 0%
#11,956 libpaho-mqtt 1 0%
#11,957 ryankask/emacs-plus/emacs-plus@32 1 0%
#11,958 msakbar/helm/terminal 1 0%
#11,959 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq 1 0%
#11,960 d12frosted/emacs-plus/emacs-plus-mymain --with-xwidgets 1 0%
#11,961 herrnst/tap/dosbox-x-revertcmos --HEAD 1 0%
#11,962 qtlottie 1 0%
#11,963 eso/pipelines/pycpl 1 0%
#11,964 iwadon/tap/terse-prompt --HEAD 1 0%
#11,965 pppobear/tap/pinentry-rbw-macos 1 0%
#11,966 libcdr 1 0%
#11,967 xdelta 1 0%
#11,968 ekinertac/tap/flick 1 0%
#11,969 railwaycat/emacsmacport/emacs-mac@29 --with-librsvg --with-mac-metal --with-native-compilation --with-retro-sink-bw 1 0%
#11,970 railwaycat/emacsmacport/emacs-mac@30exp --with-imagemagick --with-librsvg --with-mac-metal --with-native-compilation --with-retro-sink-bw --with-starter 1 0%
#11,971 thaikolja/torrentor-cli/torrentor-cli 1 0%
#11,972 pre-commit --HEAD 1 0%
#11,973 bowl42/tap/pippin-mcp 1 0%
#11,974 cc-connect 1 0%
#11,975 eeyun/qemu-spice/libepoxy-egl --HEAD 1 0%
#11,976 yukaii/tap/switchbar --HEAD 1 0%
#11,977 eddieparc/tap/aoe-ko 1 0%
#11,978 f1dg3txd/ds3pair-macos/ds3pair-macos 1 0%
#11,979 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-imagemagick --with-mailutils --with-modern-icon-purple --with-tree-sitter --with-xwidgets 1 0%
#11,980 seokminhong/brew/kfind 1 0%
#11,981 zydis 1 0%
#11,982 scrutineer 1 0%
#11,983 dgarnier/plasma/pumi 1 0%
#11,984 near 1 0%
#11,985 psp-binutils --HEAD 1 0%
#11,986 wangliyangleon/pzt/pzt-agent --HEAD 1 0%
#11,987 rgsystemes/qt4/freetds --with-universal 1 0%
#11,988 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#11,989 kandelo-dev/tap-core/dinit 1 0%
#11,990 macmon --HEAD 1 0%
#11,991 asn1c 1 0%
#11,992 omkarkirpan/tap/brewbar 1 0%
#11,993 kani 1 0%
#11,994 daviderestivo/emacs-head/emacs-head@31 --with-cocoa --with-native-comp --with-native-full-aot --with-tree-sitter --without-libxml2 1 0%
#11,995 kato1052/tap/nls 1 0%
#11,996 alex-tgk/tap/cairn 1 0%
#11,997 ola --HEAD 1 0%
#11,998 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-imagemagick --with-native-comp --with-native-full-aot --with-tree-sitter --with-xwidgets 1 0%
#11,999 daviderestivo/emacs-head/emacs-head@32 --with-cocoa --with-imagemagick --with-tree-sitter --with-xwidgets 1 0%
#12,000 apify/tap/mcpc 1 0%
#12,001 cyclonedx-node-yarn 1 0%
#12,002 antewall/tap/avanza-tools 1 0%
#12,003 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,004 apkeep 1 0%
#12,005 qtquicktimeline 1 0%
#12,006 toonetown/extras/openjdk@19 1 0%
#12,007 teamtype 1 0%
#12,008 sdl3_mixer 1 0%
#12,009 shivammathur/extensions/imap-uw 1 0%
#12,010 oh-my-agent 1 0%
#12,011 aws-lc 1 0%
#12,012 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-openssl --with-srt 1 0%
#12,013 fastani 1 0%
#12,014 mark 1 0%
#12,015 smtzdczdq/ffmpeg/ffmpeg-skyzyx 1 0%
#12,016 allscreenshots/allscreenshots/allscreenshots 1 0%
#12,017 roeme/virt-manager/libgovirt 1 0%
#12,018 harmonybrew/core/gdcm 1 0%
#12,019 gekap/blitcp/blitcp 1 0%
#12,020 harmonybrew/core/kpcli 1 0%
#12,021 shpool 1 0%
#12,022 pdfgrep --HEAD 1 0%
#12,023 gd 1 0%
#12,024 digitalspacestdio/php/php82 1 0%
#12,025 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-cairo --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,026 trunk 1 0%
#12,027 homebrew-ffmpeg/ffmpeg/ffmpeg --with-cairo --with-dvd --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,028 homebrew-ffmpeg/ffmpeg/ffmpeg --with-cairo --with-chromaprint --with-dvd --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,029 iaeieue/wsl2/n_m3u8dl-re 1 0%
#12,030 xchern/tap/strata 1 0%
#12,031 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,032 tgragnato/tap/magnetico 1 0%
#12,033 zls 1 0%
#12,034 twam/openfpga/nextpnr --without-arch-ice40 --without-arch-nexus --without-python 1 0%
#12,035 qiwei66/tap/sesame 1 0%
#12,036 tinyice 1 0%
#12,037 gianniacquisto/tap/tandem 1 0%
#12,038 raffaelefarinaro/ciaobot/ciaobot 1 0%
#12,039 osrf/simulation/ignition-rendering6 1 0%
#12,040 ktf/brews/matterbox --HEAD 1 0%
#12,041 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,042 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-dvd --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper.cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,043 stropdev/tap/strop 1 0%
#12,044 harmonybrew/core/rmux 1 0%
#12,045 rustup --HEAD 1 0%
#12,046 gwyddion --HEAD 1 0%
#12,047 brewsci/bio/sga 1 0%
#12,048 theharvester --HEAD 1 0%
#12,049 veyal/desnotch/desnotch 1 0%
#12,050 ibreaker/daka/daka 1 0%
#12,051 yorukot/superfile/superfile 1 0%
#12,052 tecolicom/tap/less 1 0%
#12,053 shiorangerin/apps/md2pic 1 0%
#12,054 hantmac/tap/tmax 1 0%
#12,055 jakobhviid/tap/demucs-cpp 1 0%
#12,056 arb-project/arb/arb --with-test 1 0%
#12,057 hlrs-vis/tap/anari-visionaray --HEAD 1 0%
#12,058 la5nta/tap/voacapl 1 0%
#12,059 inih 1 0%
#12,060 k3min/n64-dev/mips64-elf-binutils 1 0%
#12,061 jagtesh/tap/superlemon 1 0%
#12,062 egigoka/cask-notinbrew/camofox-browser 1 0%
#12,063 rafaelespinoza/godfish/godfish-dev --HEAD 1 0%
#12,064 py-swift/swiftonizeexec/swiftonizeexec 1 0%
#12,065 alnah/tap/picoloom 1 0%
#12,066 sidneys/homebrew/wireproxy 1 0%
#12,067 kde/kde/phonon 1 0%
#12,068 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-game-music-emu --with-jpeg-xl --with-libaribcaption --with-libopenmpt --with-libplacebo --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rubberband --with-srt --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#12,069 mcp-publisher 1 0%
#12,070 mawk 1 0%
#12,071 shriyanss/tap/js-recon 1 0%
#12,072 pdfio --HEAD 1 0%
#12,073 beetlebugorg/tap/charttable 1 0%
#12,074 tgtakaoka/freerouting/freerouting --HEAD 1 0%
#12,075 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-libaribb24 --with-libaribcaption 1 0%
#12,076 s3rj1k/qemu-virgl/virglrenderer 1 0%
#12,077 sextractor 1 0%
#12,078 bryaneaton13/tap/runbar 1 0%
#12,079 sidneys/homebrew/yt-dlp 1 0%
#12,080 dkblinux98/nyxgpt/nyxgpt-api 1 0%
#12,081 mufetch 1 0%
#12,082 libva 1 0%
#12,083 tgerighty/tap/clipssh-mac 1 0%
#12,084 pichu2707/tap/oxidegate 1 0%
#12,085 isurumaduranga/one-ai/one-code 1 0%
#12,086 python-tk@3.10 --HEAD 1 0%
#12,087 harmonybrew/core/atop 1 0%
#12,088 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libvmaf --with-openjpeg --with-rav1e --with-svt-av1 --with-webp 1 0%
#12,089 mikedan37/daemon-inspector/daemon-inspector 1 0%
#12,090 portablemc 1 0%
#12,091 yofriadi/opencode/opencode-nightly 1 0%
#12,092 yofriadi/opencode/opencodenightly 1 0%
#12,093 homebrew-ffmpeg/ffmpeg/ffmpeg --with-svt-av1 --with-zimg 1 0%
#12,094 jakekara/tap/bye-cloud 1 0%
#12,095 flye 1 0%
#12,096 libzen 1 0%
#12,097 noahkiss/tap/notify-mcp 1 0%
#12,098 driftctl 1 0%
#12,099 aws-amplify 1 0%
#12,100 denji/nginx/nginx-full --with-eval-module --with-geoip2-module --with-http2 --with-http3 --with-image-filter --with-rtmp-module --with-slice --with-status --with-stream --with-stream-ssl --with-stream-ssl-preread --with-upload-module --with-upstream-check-module --with-vod-module --with-websockify-module --with-xslt 1 0%
#12,101 denji/nginx/nginx-full --with-eval-module --with-geoip2-module --with-http2 --with-http3 --with-image-filter --with-rtmp-module --with-slice --with-status --with-stream --with-stream-geoip --with-stream-ssl --with-stream-ssl-preread --with-unzip-module --with-upload-module --with-upload-progress-module --with-upstream-check-module --with-vod-module --with-websockify-module --with-xslt 1 0%
#12,102 denji/nginx/nginx-full --with-auth-req --with-eval-module --with-geoip2-module --with-http2 --with-http3 --with-image-filter --with-rtmp-module --with-slice --with-status --with-stream --with-stream-geoip --with-stream-ssl --with-stream-ssl-preread --with-unzip-module --with-upload-module --with-upload-progress-module --with-upstream-check-module --with-vod-module --with-websockify-module --with-xslt --with-xsltproc-module 1 0%
#12,103 kozyrap/libimobiledevice/libimobiledevice 1 0%
#12,104 tldr 1 0%
#12,105 brewsci/num/brewsci-mumps --without-open-mpi 1 0%
#12,106 danielbair/tap/sonic-speech 1 0%
#12,107 gsl --HEAD 1 0%
#12,108 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-openmp --with-testing --without-hypre --without-mumps 1 0%
#12,109 pdf-zusammenfugen 1 0%
#12,110 xingrz/vsplugins/fmtconv 1 0%
#12,111 noctem/vapoursynth/fmtconv --HEAD 1 0%
#12,112 shivammathur/extensions/imagick@8.4 1 0%
#12,113 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,114 kalign 1 0%
#12,115 gnutls --with-xwidgets 1 0%
#12,116 codemaster-ar/gpr-hub/gpr-hub 1 0%
#12,117 efmsoft/tap/logme 1 0%
#12,118 kennyg/tap/beads-viewer 1 0%
#12,119 railwaycat/emacsmacport/emacs-mac@29 --HEAD --with-modern-icon --with-native-comp --with-native-compilation --with-starter 1 0%
#12,120 scip 1 0%
#12,121 shivammathur/extensions/uopz@7.0 1 0%
#12,122 shivammathur/extensions/seaslog@8.3 1 0%
#12,123 shivammathur/extensions/seaslog@8.4 1 0%
#12,124 naba-nyan/formulae/zathura --with-synctex 1 0%
#12,125 tleepa/tap/pinact 1 0%
#12,126 decompose 1 0%
#12,127 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-chromaprint --with-dvd --with-fdk-aac --with-webp 1 0%
#12,128 osrf/simulation/gz-launch8 1 0%
#12,129 amar1729/libguestfs/hivex 1 0%
#12,130 macaulay2/tap/mathicgb 1 0%
#12,131 bbtools 1 0%
#12,132 mehdichaouch/airport-bssid/airport-bssid --HEAD 1 0%
#12,133 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libssh --with-libvmaf --with-tesseract 1 0%
#12,134 find-process 1 0%
#12,135 sdcc@4.0.0 1 0%
#12,136 pokeget 1 0%
#12,137 pothosware/pothos/soapyaudio --HEAD 1 0%
#12,138 kazi05/swiftwui/swiftwui 1 0%
#12,139 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,140 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libflite --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,141 cloud-provider-kind 1 0%
#12,142 d12frosted/emacs-plus/emacs-plus@29 --with-debug --with-native-comp --with-xwidgets 1 0%
#12,143 tailspin 1 0%
#12,144 duck 1 0%
#12,145 jiratui 1 0%
#12,146 hlrs-vis/tap/vsgpoints 1 0%
#12,147 ssh3 1 0%
#12,148 vibecheck 1 0%
#12,149 pedrogrilo/geo-arm/gdal-jni 1 0%
#12,150 pyenv-virtualenv 1 0%
#12,151 peekaboo 1 0%
#12,152 btwld/fvm/fvm 1 0%
#12,153 octave-app/octave-app-bases/bison@3.2 1 0%
#12,154 vexctl 1 0%
#12,155 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libmodplug --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#12,156 earthbuild 1 0%
#12,157 moves-rwth/storm/stormchecker --HEAD --with-spot --with-tbb 1 0%
#12,158 lgarron/lgarron/wavify --HEAD 1 0%
#12,159 caius/tap/s3-nuke 1 0%
#12,160 railwaycat/emacsmacport/emacs-mac@29 --with-emacs-big-sur-icon --with-unlimited-select 1 0%
#12,161 ccswitch 1 0%
#12,162 d12frosted/emacs-plus/emacs-plus@31 --with-dbus --with-debug --with-imagemagick --with-mailutils 1 0%
#12,163 pegasus-isi/tools/pegasus@4 1 0%
#12,164 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-imagemagick --with-modern-black-gnu-head-icon 1 0%
#12,165 padraic-shafer/openssh-gssapi/openssh-patched --with-gssapi-support --with-keychain-support 1 0%
#12,166 railwaycat/emacsmacport/emacs-mac@29 --with-spacemacs-icon 1 0%
#12,167 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-icons-project-EmacsIcon7 --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-no-title-bars --with-starter 1 0%
#12,168 btllib 1 0%
#12,169 d12frosted/emacs-plus/emacs-plus@31 --with-imagemagick --with-savchenkovaleriy-big-sur-icon --with-xwidgets 1 0%
#12,170 scirooplot/scirooplot/scirooplot --HEAD 1 0%
#12,171 daviderestivo/emacs-head/emacs-head@30 --with-cocoa --with-dbus --with-imagemagick --with-mailutils --with-modern-icon-alecive-flatwoken --with-native-comp --with-no-frame-refocus --with-pdumper --with-tree-sitter --with-xwidgets 1 0%
#12,172 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jpeg-xl --with-libbluray --with-libcaca --with-libdvdnav --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-openjpeg --with-rtmpdump --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-webp --with-xvid --with-zimg 1 0%
#12,173 melonmanchan/lnr/lnr --HEAD 1 0%
#12,174 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-dvd --with-fdk-aac --with-jack --with-jpeg-xl --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libopenmpt --with-libplacebo --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-svt-av1 --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zimg 1 0%
#12,175 liuqijun/tap/mobile-use 1 0%
#12,176 smspp-project/smspp/smspp 1 0%
#12,177 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libmodplug --with-libopenmpt --with-librist --with-librsvg --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#12,178 asyncvlsi/tap/actflow --HEAD 1 0%
#12,179 adityaanilraut/coderai/coderai 1 0%
#12,180 bazel@8 1 0%
#12,181 ferron 1 0%
#12,182 qtscxml 1 0%
#12,183 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,184 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-librist --with-openssl@3 1 0%
#12,185 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-fdk-aac --with-librist --with-libsoxr --with-libvmaf --with-openssl --with-srt --with-zeromq 1 0%
#12,186 christopherkarani/wax/wax 1 0%
#12,187 railwaycat/emacsmacport/emacs-mac@29 --with-dbus --with-emacs-icons-project-EmacsIcon7 --with-imagemagick --with-librsvg --with-mac-metal --with-native-comp --with-starter --with-xwidgets 1 0%
#12,188 hierarchy-builder 1 0%
#12,189 vowpal-wabbit 1 0%
#12,190 justmeetpatel/zit/zit 1 0%
#12,191 theapplegates/kleopatra6mac/kf6-ktextwidgets 1 0%
#12,192 antoniovazquezblanco/core/cwalk 1 0%
#12,193 gensio 1 0%
#12,194 clinfo 1 0%
#12,195 ruff --HEAD 1 0%
#12,196 pixtuoid 1 0%
#12,197 osi 1 0%
#12,198 pkryger/emacsmacport-exp/emacs-mac-exp@31 --HEAD --with-arc --with-mac-metal --with-modern-icon --with-optimization-flags --with-unlimited-select --with-xwidgets 1 0%
#12,199 yurijmikhalevich/tap/torchvision-python312@0.20.1 1 0%
#12,200 darwin-containers/formula/dockerd 1 0%
#12,201 jayfarei/opentraces/opentraces --HEAD 1 0%
#12,202 pascalebeier/hitkeep/hitkeep 1 0%
#12,203 jakob-bagterp/colorist/colorist 1 0%
#12,204 diskd-ai/ccbox/ccbox 1 0%
#12,205 amiaopensource/amiaos/deckcontrol 1 0%
#12,206 bsdiff 1 0%
#12,207 homebrew-ffmpeg/ffmpeg/ffmpeg --with-libplacebo --with-librist --with-libxml2 --with-libzvbi --with-rtmpdump --with-srt --with-zimg 1 0%
#12,208 ptex 1 0%
#12,209 quirkdom/tap/calm 1 0%
#12,210 fitzcapital/tap/fitz --HEAD 1 0%
#12,211 markmals/tap/wasmer 1 0%
#12,212 waltarix/customs/zsh 1 0%
#12,213 fail2ban --HEAD 1 0%
#12,214 dwarfutils 1 0%
#12,215 ericermerimen/tap/agentpong 1 0%
#12,216 namolnad/formulae/finch 1 0%
#12,217 jcdangelo/local-kubelogin/kubelogin 1 0%
#12,218 brewsci/bio/meme 1 0%
#12,219 nats 1 0%
#12,220 sagarsuri/tap/ado-pipeline 1 0%
#12,221 wyrd-company/tools/t3c 1 0%
#12,222 elmercsc/elmerfem/elmer --HEAD --with-elmergui --with-hypre --with-openmp --with-testing 1 0%
#12,223 ranger 1 0%
#12,224 xsane --HEAD 1 0%
#12,225 rio-terminal --HEAD 1 0%
#12,226 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-chromaprint --with-decklink --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libdvdnav --with-libdvdread --with-libflite --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-svt-av1 --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,227 uhubctl 1 0%
#12,228 harmonybrew/core/openssl 1 0%
#12,229 ignite-swift 1 0%
#12,230 kreeblah/smpq-tap/smpq 1 0%
#12,231 python@3.15 --with-cocoa --with-native-comp --with-tree-sitter 1 0%
#12,232 jamesy0ung/tap/insert-dylib --HEAD 1 0%
#12,233 digitalspacestdio/php/php85-imap 1 0%
#12,234 c3c 1 0%
#12,235 oponite/nitebrews/lana@1.0.0 1 0%
#12,236 libiptcdata 1 0%
#12,237 nkaaf/tap/git-profiles 1 0%
#12,238 matthewyang204/formulae-casks/genignore 1 0%
#12,239 ublue-os/experimental-tap/linux-mcp-server 1 0%
#12,240 d12frosted/emacs-plus/emacs-plus@31 --with-compress-install --with-debug --with-xwidgets 1 0%
#12,241 vcfexpress 1 0%
#12,242 tkersey/tap/cron 1 0%
#12,243 octave-app/octave-app/octave@9.1.0 --without-docs 1 0%
#12,244 jp2a 1 0%
#12,245 rfidresearchgroup/proxmark3/proxmark3 --HEAD --with-blueshark --with-generic 1 0%
#12,246 libsass 1 0%
#12,247 xinding33/tap/wink 1 0%
#12,248 nativeos/i386-elf-toolchain/i386-elf-binutils --HEAD 1 0%
#12,249 capnp 1 0%
#12,250 dorkitude/tap/skimmer 1 0%
#12,251 zambozoo/zam/zam 1 0%
#12,252 tenere 1 0%
#12,253 sportsball-ai/ffmpegsrt/ffmpegsrt 1 0%
#12,254 homebrew-ffmpeg/ffmpeg/ffmpeg --HEAD --with-aribb24 --with-chromaprint --with-dvd --with-fdk-aac --with-game-music-emu --with-jack --with-jpeg-xl --with-libaribb24 --with-libbluray --with-libbs2b --with-libdvdread --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-openal-soft --with-openapv --with-opencore-amr --with-openjpeg --with-openssl --with-openssl@3 --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#12,255 omonimus1/facetimectl/facetimectl 1 0%
#12,256 aakarsh-goyal/macjuice/macjuice 1 0%
#12,257 bigsy/tap/mcpmu 1 0%
#12,258 nnsuite/neural-network/nnstreamer 1 0%
#12,259 yoshikouki/applefm/applefm 1 0%
#12,260 cbrunnkvist/tap/ttylag 1 0%
#12,261 rosco-m68k/toolchain/rosco-m68k-toolchain@13 1 0%
#12,262 eso/pipelines/esopipe-molecfit 1 0%
#12,263 leopard-gecko/game/jrogue-clone 1 0%
#12,264 jesusgamer1213/tools/filecompress 1 0%
#12,265 tzatzosm/tap/project-navigator 1 0%
#12,266 jacobfgrant/tap/unity-rearm 1 0%
#12,267 cxwx/cxbrew/mihomo-tui 1 0%
#12,268 skyman/gt/nin10kit 1 0%
#12,269 ampl-mp 1 0%
#12,270 dan13681989/cleanmac/cleanmac-pro 1 0%
#12,271 melt 1 0%
#12,272 broadinstitute/dsp/cromshell 1 0%
#12,273 grafana/grafana/sigil 1 0%
#12,274 libblake 1 0%
#12,275 a1local/adpages-tap/adpages 1 0%
#12,276 tokenbot-org/tokenbot/tokenbot 1 0%
#12,277 go@1.16 1 0%
#12,278 canonical-chisel 1 0%
#12,279 harmonybrew/core/p11-kit 1 0%
#12,280 smartdns 1 0%
#12,281 homebrew-ffmpeg/ffmpeg/ffmpeg --with-decklink --with-rav1e --with-rubberband --with-srt 1 0%
#12,282 tiennesdm/vedadb/vedadb-server --HEAD 1 0%
#12,283 nanovms/toolchains/aarch64-linux-binutils 1 0%
#12,284 mohamed-khalil-ben-nasr/tools/try 1 0%
#12,285 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-game-music-emu --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libopenmpt --with-libplacebo --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rubberband --with-srt --with-two-lame --with-webp --with-xvid --with-zeromq --with-zimg 1 0%
#12,286 elijah/tap/botfile --HEAD 1 0%
#12,287 zint --HEAD 1 0%
#12,288 brewsci/bio/star-aligner 1 0%
#12,289 omlx 1 0%
#12,290 jason-dour/tap/hugo-preproc 1 0%
#12,291 diffblue/cbmc/cbmc@6.10.0 1 0%
#12,292 ymkthr/tap/karukan 1 0%
#12,293 co-index/tap/ccnotify 1 0%
#12,294 lightnow-ai/tap/lightnow-proxy 1 0%
#12,295 pathanin/find_duplicates/find-duplicates 1 0%
#12,296 homebrew-ffmpeg/ffmpeg/ffmpeg --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,297 dtc --HEAD 1 0%
#12,298 benzolium/tap/raskraska 1 0%
#12,299 juju 1 0%
#12,300 brewsci/bio/pmemd 1 0%
#12,301 homebrew-ffmpeg/ffmpeg/ffmpeg --with-alt-name --with-aribb24 --with-dvd --with-fdk-aac --with-game-music-emu --with-ggml --with-jack --with-jpeg-xl --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libtensorflow --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openal-soft --with-openapv --with-opencore-amr --with-openh264 --with-openjpeg --with-openssl --with-openssl@3 --with-openvino --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tensorflow --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,302 zk --HEAD 1 0%
#12,303 harmonybrew/core/vcpkg 1 0%
#12,304 sphericalflower52811/tap/endpointscanner 1 0%
#12,305 qkdxorjs1002/tap/libkrun 1 0%
#12,306 mole --HEAD 1 0%
#12,307 numkong 1 0%
#12,308 e2fsprogs --HEAD 1 0%
#12,309 reinforceai/spiral/spiral 1 0%
#12,310 qjackctl 1 0%
#12,311 sidneys/homebrew/ffmpeg --with-srt 1 0%
#12,312 sheldon --HEAD 1 0%
#12,313 oops-rs/tap/langcodec-cli 1 0%
#12,314 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libplacebo --with-libvmaf --with-openssl --with-rav1e --with-zimg 1 0%
#12,315 tzvetkoff/extras/im2a 1 0%
#12,316 libvirt --HEAD 1 0%
#12,317 sidaf/pentest/cewl 1 0%
#12,318 pdfio 1 0%
#12,319 rdiff-backup 1 0%
#12,320 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-libaribb24 --with-libaribcaption --with-libbluray --with-libbs2b --with-libcaca --with-librist --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libxml2 --with-libzvbi --with-openh264 --with-openjpeg --with-rtmpdump --with-speex --with-srt --with-tesseract --with-webp --with-whisper-cpp --with-zeromq --with-zimg 1 0%
#12,321 longbui99/aistatusbar/ai-status-bar 1 0%
#12,322 aayush9029/tap/icn 1 0%
#12,323 jira-cli --HEAD 1 0%
#12,324 osgeo/osgeo4mac/osgeo-laszip@2 1 0%
#12,325 denji/nginx/nginx-full --with-accept-language-module --with-accesskey-module --with-addition --with-ajp-module --with-anti-ddos-module --with-array-var-module --with-auth-digest-module --with-auth-ldap-module --with-auth-pam-module --with-auth-req --with-auto-keepalive-module --with-autols-module --with-brotli-module --with-cache-purge-module --with-captcha-module --with-dav-ext-module --with-debug --with-degredation --with-dosdetector-module --with-echo-module --with-eval-module --with-extended-status-module --with-fancyindex-module --with-flv --with-gd --with-google-perftools --with-gperftools --with-gunzip --with-gzip-static --with-headers-more-module --with-healthcheck-module --with-homebrew-libressl --with-http-accounting-module --with-http-flood-detector-module --with-http-remote-passwd-module --with-http2 --with-http3 --with-image-filter --with-imlib2 --with-log-if-module --with-lua-module --with-mail --with-mail-ssl --with-mod-zip-module --with-mp4 --with-mp4-h264-module --with-mruby-module --with-naxsi-module --with-nchan-module --with-njs-module --with-notice-module --with-passenger --with-pcre-jit --with-perl --with-php-session-module --with-push-stream-module --with-random-index --with-realip --with-realtime-req-module --with-redis-module --with-redis2-module --with-rtmp-module --with-secure-link --with-set-misc-module --with-slice --with-small-light-module --with-status --with-stream --with-stream-geoip --with-stream-realip --with-stream-ssl --with-stream-ssl-preread --with-sub --with-subs-filter-module --with-tcp-proxy-module --with-txid-module --with-unzip-module --with-upload-module --with-upload-progress-module --with-upstream-check-module --with-upstream-order-module --with-ustats-module --with-var-req-speed-module --with-vod-module --with-vts-module --with-webdav --with-websockify-module --with-xslt --with-xsltproc-module 1 0%
#12,326 denji/nginx/nginx-full --with-accept-language-module --with-accesskey-module --with-addition --with-ajp-module --with-anti-ddos-module --with-array-var-module --with-auth-digest-module --with-auth-ldap-module --with-auth-pam-module --with-auth-req --with-autols-module --with-brotli-module --with-cache-purge-module --with-captcha-module --with-dav-ext-module --with-debug --with-degredation --with-dosdetector-module --with-echo-module --with-eval-module --with-fancyindex-module --with-flv --with-gd --with-google-perftools --with-gperftools --with-gunzip --with-gzip-static --with-headers-more-module --with-healthcheck-module --with-homebrew-libressl --with-http-accounting-module --with-http-flood-detector-module --with-http-remote-passwd-module --with-http2 --with-http3 --with-image-filter --with-imlib2 --with-log-if-module --with-lua-module --with-mail --with-mail-ssl --with-mod-zip-module --with-mp4 --with-mp4-h264-module --with-mruby-module --with-naxsi-module --with-nchan-module --with-njs-module --with-notice-module --with-passenger --with-pcre-jit --with-perl --with-php-session-module --with-push-stream-module --with-random-index --with-realip --with-realtime-req-module --with-redis-module --with-redis2-module --with-rtmp-module --with-secure-link --with-set-misc-module --with-slice --with-small-light-module --with-status --with-stream --with-stream-geoip --with-stream-realip --with-stream-ssl --with-stream-ssl-preread --with-sub --with-subs-filter-module --with-tcp-proxy-module --with-txid-module --with-unzip-module --with-upload-module --with-upload-progress-module --with-ustats-module --with-var-req-speed-module --with-vod-module --with-vts-module --with-webdav --with-websockify-module --with-xslt --with-xsltproc-module 1 0%
#12,327 davidchall/hep/mcfm --with-lhapdf 1 0%
#12,328 gu-csc/csc-toolchain/csc 1 0%
#12,329 di 1 0%
#12,330 ask-sol/openagent/openagent 1 0%
#12,331 cleanhyune/yp/yp 1 0%
#12,332 armadillo 1 0%
#12,333 badluma/homebrew/comprobot 1 0%
#12,334 databendcloud/tap/bendsql 1 0%
#12,335 harmonybrew/core/libgpg-error 1 0%
#12,336 harmonybrew/core/jemalloc 1 0%
#12,337 microsoft/mssql-release/msodbcsql18@18.3.3.1 1 0%
#12,338 shivammathur/extensions/imap@8.3 1 0%
#12,339 lazy-tmux 1 0%
#12,340 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-openh264 --with-openjpeg --with-rav1e --with-webp 1 0%
#12,341 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-openjpeg --with-rav1e --with-webp 1 0%
#12,342 zapp 1 0%
#12,343 homebrew-ffmpeg/ffmpeg/ffmpeg --with-chromaprint --with-fdk-aac --with-openh264 --with-openjpeg --with-rav1e --with-webp 1 0%
#12,344 homebrew-ffmpeg/ffmpeg/ffmpeg --with-fdk-aac --with-jpeg-xl --with-openh264 --with-openjpeg --with-rav1e --with-webp 1 0%
#12,345 homebrew-ffmpeg/ffmpeg/ffmpeg --with-aribb24 --with-chromaprint --with-fdk-aac --with-jpeg-xl --with-libbluray --with-libbs2b --with-libgsm --with-libmodplug --with-libopenmpt --with-libplacebo --with-librist --with-librsvg --with-libsoxr --with-libssh --with-libvidstab --with-libvmaf --with-libzvbi --with-opencore-amr --with-openh264 --with-openssl --with-rav1e --with-rtmpdump --with-rubberband --with-speex --with-srt --with-tesseract --with-two-lame --with-webp --with-whisper-cpp --with-xvid --with-zeromq --with-zimg 1 0%
#12,346 qtshadertools --HEAD 1 0%
#12,347 kew --HEAD 1 0%
#12,348 aconchillo/guile/guile-dbi 1 0%